Društvo genetičara Srbije

 

PRVI KONGRES GENETIČARA SRBIJE

 

Vrnjačka Banja, 08-11 juni, 1994

 

 


 




 

Predsedništvo Kongresa

Vukica DIKLIĆ

Janko DUMANOVIĆ

Dragoslav MARINKOVIĆ

Aleksandar KRSTIĆ

Ana SAVIĆ

Bogosav SOLDATOVIĆ

Aleksandar TUCOVIĆ

 

Organizacioni odbor

Kosana KONSTANTINOV, predsednik

Marija Kraljević-Balalić, potpredsednik

Nada BARJAKTAREVIĆ, generalni sekretar

Marko Anđelković

Dragan ALAVANTIĆ

Vasilije Isajev

Mile IVANOVIĆ

Vesna LAZIĆ-JANČIĆ

Miroslava MICIĆ

Teodora PAPIĆ-PALJIĆ

Gojko SAVIĆ

Draga SIMIĆ

Vitomir VIDOVIĆ

Ljubiša TOPISIROVIĆ

Branka TUCIĆ

 

Sekretarijat Kongresa

Miodrag DIMITRIJEVIĆ

Jelena KNEŽEVIĆ

Desmir KNEŽEVIĆ

Vera ROBOVIĆ

Goran SARATLIĆ

Ljiljana VAPA

Mladen VUJOŠEVIĆ



 

Društvo genetičara Srbije

 

PRVI KONGRES GENETIČARA SRBIJE

 

Vrnjačka Banja, 08-11 juni, 1994

 

S A D R Ž A J

 

Simpozijum 1. CITOGENETIKA

 

B. Soldatović

Retrospektive razvoja citogenetike

 

Jovanka Atlagić

Citogenetska istraživanja interspecies hibrida suncokreta (H. annum L. x H. occidentalis Riddelt)

 

Jelena Blagojević i Vujošević M.

Distribucija konstitutivnog heterohromoatina i nukleolusnih organizatora kod guštera iz familije Lacertidae (Sauriaj)

 

N. Đelić, B. Soldatović i M. Anđelković

Uticaj oksitocina na mitotsku aktivnost i pojavu hromozomskih aberacija u kulturama limfocita periferne krvi čoveka

 

Svetlana Fišter i B. Soldatović

Učestalost promena tipa gapa i prekida na hromozomima riba vrste Stiziostedion Volgense (Percidea) uhvaćenih na nekim lokalitetima Dunava

 

Drinka Merćap, A. Đujić, Z. Magić i M. Simović

Različiti odgovori na genotoksičan agens u zavisnosti od genetičke konstitucije

 

Snežana Mezei, L. Kovačević i N. Čačić

Delovanje kolhicina na neka kvantitativna svojstva šećerne repe

 

B.P. Pavlović

Metod izrade numeričkih etalona kariotipa

 

B.P. Pavlović

Numerički etaloni kariotipova Erinaceus europaeus europaeus

 

B. Pavlović, i Nevenka Pavlović

Odnos komponenti varijacije unutar kariotipa sisara i riba: Indeksi parcijalnog centromernog opterećenja krakova i indeksi centromernog opterećenja

 

Slavica Simović i G. Marković

Hromozomski komplementi nekih riba iz familije Cyprinidae

 

Z. Stanimirović, Mirjana Vučinić, B. Soldatović, E. Herzog

Veliki akrocentricni hromozom iz prvog para autozoma prirodnih populacija, vrste Mus musculus, Linne 1758

 

S. Šesek

Citogenetičke karakteristike regeneranata dobijenih iz antera pšenice (Triticum aestivum L.) gajenih u kulturi in vitro

 

N. Tanić, Olivera Spasić, Jelena Blagojević i M. Vujošević

Hromozomi žaba iz familije Ranidae (Anura, Amphibia) uporedna analiza

 

Marijana Vučinić, Z. Stanimirović, B. Soldatović

 „ROSOL“ kao mogući induktor numeričkih hromozomskih aberacija poliploidnog tipa

 

M. Vujošević i Jelena Blagojević

Interpopulacioni polimorfizam b-hromozoma kod šumskog miša, Apodemus flavicollis (Mammalia, Rodentia)

 

 

Simpozijum 2. MEDICINSKA GENETIKA

 

Slavenka Adžić, Stefanija Marković, D. Plećaš, N. Radunović i Z. Pilić

Hromozomske abericije otkrivene cordocentezom

 

Nevenka Aleksić

Genetoksikološka karakterizacija ivermektina i prazikvantela u in vitro uslovima

 

M. Babić i M. Micić

Cefalometrijska analiza osoba sa klinefekterovim sindromom

 

S. Branković i G. Savić

Stepen genetičke homozigotnosti kod duševno obolelih i zdravih osoba stanovišta prištine i okoline

 

Dragana Cvetković, Marina Stojanović, V. Kostić

Genetička analiza idiopatske fokalne distonije

 

Suzana Cvjetičanin i D. Marinković

Utvrđivanje stepena genetičke homozigotnosti kod bolesnika sa urođenom displazijom kuka i u kontrolnom uzorku školske dece Beograda

 

N. Dedović, J. Milašin, V. Petrović, G. Stamenković, M. Gavrić, Z. Nikolić

Visoka učestalost tačkastih mutacija na h-ras genima u dva tipa tumora glave i vrata

 

Vukosava Diklić, Marija Kosanović, Milica Todorić, M. Vukotić, S.P. Stojković

Uloga genetičkih činilaca u etiopatogenezi kardiovaskularnih poremećaja

 

Nada Dimković, Vitana Kostić, Dragan Jovanović i Nada Barjaktarović

Citogenetska analiza otkriva "atipične ćelije" u tečnosti posle peritonealne dijalize

 

B. Đorđević, D. Mihailović, D. Stojanović, C. Kutlešić, M. Čekerevac, Z. Popović i Z. Stanković

Histološka slika ovarijuma kod bolesnice sa turner-ovim sindromom

 

Slobodanka Grković i Vesna Ivanović-Deretić

Prikaz porodične translokacije 9p/10p

 

Marija Guć-Šćekić, Dragana Anđelković, V. Jurukovski i Gordana Pilić-Radivojević

Genetičke determinante kao dijagnostički i prognostički parametar kod neuroblastoma

 

Vesna Ivanović-Deretić, Slobodanka Grković i B. Garzičić

Prikaz slučaja autozomalne translokacije celih krakova hromosoma t/2p5p;2q5q/

 

Zorica Janakova

Populacioni genetičar u (pre)kliničkoj praksi hroničnih masovnih oboljenja

 

Zorica Janakova

Značaj prethodnog odabira osoba sa povišenim rizikom prema šećernoj bolesti u sistematskom pregledu ciljanom na otkrivanje ranih stadijuma ovog oboljenja

 

Zorica Janakova

Humoralni činioci varijatilnosti alergijske reaktivnosti

 

Gordana Jokšić

Hromozomske aberacije i cb mikronukleusni test kao komparativne metode u biodozimetriji jonizujućeg zračenja

 

Dragana Jovanović i D. Marinković

Analiza učestalosti genetički kontrolisanih kvalitativnih osobina u uzorku žena obolelih od kancera dojke i kod rizične i kontrolne grupe

 

J. Jovanović-Privrodski, A. Krstić, F. Popić-Paljić, R. Aleksić i G. Raca

EUROCAT u Vojvodini

 

J. Jovanović-Privrodski, A. Krstić, F. Popić-Paljić, Z. Pilić

Hlasistem-genetski marker za prenatalnu dijagnostiku juvenilnog dijabetes melitusa (Prikaz slučaja)

 

Vesna Knežević, Vukosava Diklić, Marija Kosanović i N. Vojvodić

Genetička istraživanja kardiovaskularnih oboljenja

 

M. Krajinović, K. Ivanović, L. Mestroni, V. Diklić i J. Nikoliš

Poreklo x hromozoma u pacijenta sa Robertsonovom translokacijom i Tarnerovim sindromom

 

A. Krstić, M. Kovačević, G. Raca, F. Popić-Paljić, J. Jovanović-Privrodski, R. Aleksić, N. Čamber, R. Madžar, V. Čihi, Lj. Gaćina, N. Mitrovčan i Lj. Malešević

Registracija hromozomskih aberacija metodom D.S. Borgoankara-Repos

 

M. Krstić, Stefanija Marković i Slavenka Adžić

Moralno-etički aspekt prenatalne dijagnoze naslednih oboljenja

 

Živana Laca

Citogenetička ispitivanja u medicinskoj genetici

 

Milena Ludoski, Ljiljana Lalić, Vera Popović, V. Jurukovski i Angelina Novak

Upotreba fluorescentne in situ hibridizacije za identifikaciju marker hromozoma kod pacijenata sa tarnerovim sindromom

 

B. Lukić, Nada Barjaktarović, Nada Todorović i Vitana Kostić

RING (15) - prikaz slučaja

 

Ljiljana Luković, Jelena Milašin, N. Arsenović i Vukosava Diklić

Hromozomske aberacije u tri ovarijalna karcinoma

 

D. Marinković, D. Jovanović, S. Cvjetičanin i S. Branković

Genetička homozigotnost i normalna i patološka humana varijabilnost

 

Miroslava Mićić

Uticaj aberacija polnih hromozoma na spermatogenezu

 

D. Mihailović, Z. Stanković, B. Đorđević, V. Mihailović i M. Čekerevac

Zapremina jedara u Patauovom sindromu

 

V. Mihailović, Z. Stanković, D. Mihailović i D. Stojanović

Učestalost akrocentričnih asocijacija kod žena sa spontanim abortusom

 

Jelena Milašin, Nasta Dedović, S. Mićić, B. Dimitrijević, Vukica Diklić

Mutacije H-ras gen a u tumorima urinarnog trakta čoveka

 

Olivera Milošević-Đorđević i Nada Barjaktarović

Reakcija humanih t limfocita u diferenciranom i nediferenciranom stanju na dejstvo mafosfamida i 5-fluorouracila in vitro

 

S. Minić, M. Kosanović i B. Petrović

Citogenetsko ispitivanje hromozoma bolesnika sa incontinentio pigmenti

 

J. Nikoliš, V. Kekić, S. Mićić, V. Diklić, M. Ristanović

Ag - NOR - ovi u normalnoj humanoj populaciji

 

Angelina Novak, Đ. Kokai, Vera Popović, Milena Ludoški, V. Jarukovski

Interfazna citogenetika: otkrivanje genomske konstitucije jajnika (histološki preparati) u bolesnika sa Turner sindromom i hromozomskim mozaicizmom

 

Ivana Novaković, Olga Antonović, Slavenka Adžić i Svjetlana Maglajić

Monosomija hromosoma 22 - prikaz slučaja

 

V. Novosel

Genetički prikaz porodice sa učestalom Polydactilyom

 

Vesna Pendić, Vera Popović i Angelina Novak

Familijarna 46, XY gonadalna dizgeneza

 

D. Pešut, D. Marinković

Učestalost krvnih grupa ABO sistema u nekim plućnim bolestima

 

F. Popić-Paljić, A. Krstić, J. Jovanović-Privrodski, R. I Aleksić i G. Raca

Genetičko savetovanje bračnih parova u slučaju delovanja štetnih noksi iz spoljne sredine

 

F. Popić-Paljić, A. Krstić, J. Jovanović-Privrodski, G. Raca i R. Aleksić

Upotreba savremenih softvera u dijagnostici retkih sindroma

 

Branka Popović, B. Garzičić i Biljana Spremo

Fragilna mesta i onkogeni kao mogući rizik za razvoj neoplazija kod nosioca balansiranih translokacija

 

G. Raca, A. Krstić, B. Garzičić, F. Popić-Paljić, J. Jovanović-Privrodski, R. Aleksić, N. Čamber, R. Madžar, V. Čihi, Lj. Gaćina, N. Mitrovčan i Lj. Malešević

Indukcija fragilnih mesta na hromozomima čoveka afidikolnom i citozin-arabinozidom

 

Dragica Radojković, Ana Savić, J. Savić, P. Minić i B. Brukner-Dabović

Primena metoda rekombinantne DNK u prenatalnoj dijagnozi cistične fibrioze

 

S. Radulović, Nada Barjaktarović i Vitana Kostić

Retka varijanta kariotipa 47,XY, +13 u AML tipa M2

 

O. Ristić, Ž. Laća, S. Nikšić, N. Aranđelović i I. Timotijević

Potomstvo nosilaca recipročnih translokacija u zavisnosti od tipa segregacije, distribucije i mesta prekida na hromozomima

 

Biljana Spremo i B. Garzičić

Fragilna mesta afidikolin tip a kao ciljne tačke delovanja jonizirajućeg zračenja

 

L.N. Stojanović, E. L. Nassonov i M. Stanić

Lupus antikoagulantna antitela/antitela na kardiolipin i kliničke manifestacije u SLE pacijenata i članova njihove familije

 

Nada Todorović, B. Lukić i Nada Barjaktarović

Citogenetski pokazatelji pri tretmanima u perinatologiji

 

 

Simpozijum 3. MOLEKULARNA GENETIKA I GENETIČKO INŽENJERSTVO

 

Desanka Božin i Gordana Cerović

Efikasnost prepoznavanja nekoplementarnih baznih parova III. Efikasnost prepoznavanja nekomplementarnih baznih parova u etioplastu

 

Desanka BOŽIN, Gordana CEROVIĆ i RADMAN

Efikasnost prepoznavanja nekomplementarnih baznih parova I. Prepoznavanje nekomplementarnih baznih parova u sisarskom jedru

 

Desanka Božin, Gordana Cerović i RADMAN

Efikasnost prepoznavanja nekomplementarnih baznih parova II. Efikasnost prepoznavanja različitih konformacija nekomplementarnog baznog para u sisarskom jedru

 

Sanja Glišić, Ivana Savić i Alavanić

Upotreba polimorfizma DNK u visoko polimorfnom regionu (3'hvr) humanog gena za apob u indikaciji genoma

 

Sanja GLIŠIĆ, Ivana SAVIĆ i ALAVANTIĆ

Polimorfizmi DNK gena za apolipoprotein B (EcoRI i MspI) i nivoi lipida u serumu u normolipidemične populacije Srbije; interakcije retkih alela, pušenja i nivoa holesterola

 

Sanja Glišić, Ivana Savić i Alavantić

Višealelni polimorfizam dnmk na 3' kraju gena za ApoB(HVR) inivoilipida u serumu kod normolipidičnih osoba

 

Sanja Glišić, Ivana Savić, Nadežda Radoja i Alavantić

Polimorfizam DNK u signalnom peptidu (insercija/delecija) gena za apolipoprotein B

 

Đ. Fira, M. Kojić, A. Banina i Lj. Topisirović

Ekstracelularne proteinaze mezofilnih laktobacila

 

Radmila V. Ivanišević, Mirjana M. Milić, Dragana S. Ajdić, Milija Z. Jovičić, Mila J. Janković i J. Savić

Nukleotidna sekvenca i transkripciona analiza nov gena odgovornog za rezistenciju bakterije E. coli K12 na antibiotik novobiocin

 

Mila J. Janković, Mirjana M. Milić, Radmila V. Ivanišević, Z. Jovičić i J. Savić

Replikacija i mutageneza: analiza visoko mutabilne sekvence poreklom iz hisC gena bakterije E. coli

 

Z. Jovičić, Mirjana M. Milić, Radmila V. Ivanišević, Mila J. Janković i D. Savić

lieS i glnF mutanti E. coli pokazuju povećanu rezistenciju na antibiotik novobiocin

 

Knežević-Vukčević, B. Čuljković, M. Vulović, B. Vuković-Gačić i D. Simić

Efekat bioantimutagena na intrahromozomalnu rekombinaciju kod Escherichia coli K12 J.

 

M. Kojić, Lj. Topisirović

Molekularna analiza velikog plazmida pS50-290 soja Lactococcus laclis subsp. laclis biovar. diacetylactis

 

Kojić, Topisirović, Branka Vasiljević

Regulacija ekspresije sgm gena bakterije Micromonospora zionensis

 

Kosana Konstantinov, Snežana Mladenović, Snezana Gošić, G. Saratlić, N. Delić, R. Petrović

Tehnologija rekombinantne DNK u patentiranju biljnih vrsta i zaštiti autorskih prava

 

Konstantinović, Sanja Ivković i Glišin

Temperaturno zavisna aktivnost hibridnih Escherichia coli promotora

 

Koviljka Krtolica, Nadežda Urošević, Dobrila Nešić, Ljiljana Tukić, Z. Magić i B. Dimitrijević

Aktivacija onkogena u pacijenata sa mieloidnom neoplazijom

 

Vesna Lazić-Jančić, D. Kovačević, A. Steed i S.A. Quarrie

Genotipski-specifična akumulacija RAB17 iRNK u listovima kukuruza tokom stresa suše

 

Vesna Lazić-Jančić, C. Lebreton, A. Steed i S.A. Quarrie

Ispitivanje genskih lokusa (QTL) za produkciju abscisinske kiseline pomoću RFLP markera

 

Z. Magić, Svetlana Matić i G. Poznanović

Radijacijom indukovana ekspresija gena za proteine akutne faze u jetri pacova

 

Vesna Maksimović, Svetlana Radović, Erika Varkonji i Ana Savić

Analiza iRNK semena heljde u sazrevanju

 

Jelena Marjanović, V. Glišin i Zvezdana Popović

67kD protein u membrani eritrocita beogradskog anemičnog pacova

 

N. Miladinov, B. Bojović, M. Kojić, A. Banina i Lj. Topisirović

Analiza regulatornog domena prt gena Lactococcus lactis subsp. lactis BGIS29

 

Mirjana M. Milić, M.Z. Jovičić, Radmila V. Ivanišević, Mila J. Janković i J. Savić

Novi cysB regulisani gen koji utiče na novobiocinsku rezistenciju cysB mutanata Escherichia coli

 

Snežana Mladenović, Kosana Konstantinov, Bojana Tadić i G. Saratlić

Uticaj bakterijskih gena na polimorfizam multiplih alela kukuruza

 

Sonja Pavlović, Tatjana Mitrović, Glišin i Zvezdana Popović

Analiza distalnog promotora bminy - globinskog gena pacova

 

S. Radoja, M. Konstantinović i V. Glišin

Proučavanje regulacije aktivnosti gena za penicilin g amidazu iz Esherichia coli fuzijom sa divergentnim reporter genima

 

Svetlana Radović, Vesna Maksimović i Ana Savić

Karakterizacija 13 s globulina semena heljde

 

Ivana Savić, Sanja Glišić, Nadežda Radoja i D. Alavantić

Polimorfizam DNK gena za Apo AI-CIII (Sstl) inivoilipida u serumu kod normolipidemičnih osoba

 

Ivana Savić, Sanja Glišić, Nadežda Radoja i D. Alavantić

Polimorfizam DNK gena za Apo B (Xbal) i nivoi lipida u serumu kod normolipidemičnih osoba

 

S. Stanković, J. Knežević-Vukčević, B. Vuković-Gačić i D. Simić

Izučavanje mehanizama reparacije kod različitih podvrsta Bacillus thuringiensis

 

Milena Stevanović i P.N. Goodfellow

Kloniranje i karakterizacija humanog SOX3 gena

 

I. Stojanović, M. Vujičić i Lj. Topisirović

Izučavanje stabilnosti plazmida pAl bakterije Lactobacillus plantarum A112

 

J. Svirčević, M. Kojić, A. Banina i Lj. Topisirović

Genetička i biohemijska karakterizacija bakteriocina bakterije Laclobacillus casei subsp. pseudoplantarum BGUB9

 

Nataša Trutić, Koviljka Krtolica, M. Čolić i Z. Mugić

Ekspresija gena za albumin i a-fetoprotein u jetri AO pacova nakon hepatektomije i višekratnog zračenja

 

Branka, M. Kojić,  Lj. Topisirović

Izučavanje rezistencije na higromicin B u sojevima roda Micromonospora

 

Miloš Vujanac, Vesna Todorović, Snežana Kojić, Ana Savić i Dragana Stefanović

Elektrohromozomska replikacija plazmida u embrionima vinske mušice

 

Nataša Vukov, Snežana Kojić, Lj. Topisirović i Branka Vasiljević

Analiza plazmida pMZ1 iz bakterije Micromonospora zionensis

 

 

Simpozijum 4. OPLEMENJIVANJE ORGANIZAMA

 

D. S. Adamović, B. Pekić i Z. Lepojević

Mogućnost selekcije Digitalis lanola Ehrh. i Datura innoxia Mill. na povećan sadržaj aktivnih materija

 

J. Boćanski, M. Stojaković

Način nasleđivanja i efekat gena žetvenog indeksa i prinosa zrna po biljci kod kukuruza (Zea mays L.)

 

V. Bogdanović, D. Radojković, Radica Vidić-Dedović i P. Stojić

Metode ocene aditivne genetske komponente nasleđa

 

Jelena Bošković i M. Bošković

Uticaj spoljnih uslova na otporne hibride pšenice prema Puccinia recondita tritici kod modeliranja uzajamnih gen-za-gen odnosa

 

R. Cerović

Proučavanje procesa mikrogametogeneze in vitro kod višnje

 

N. Čačić, L. Kovačev i Snežana Mezei

Kombinacione sposobnosti za indeks lisne površine (LAI) kod šećerne repe (Beta vulgaris L.)

 

M. Dimitrijević, Sofija Petrović i Marija Kraljević-Balalić

Analiza efekta gena u nasleđivanju broja zrna po klasu pšenice

 

B. Dozet, R. Marinković

Rekurentna selekcija na fenotip konzumnog tipa suncokreta (Helianlhus annuus L. var. macrocarpus Ckll.)

 

G. Drinić, M. Ivanović i Jelena Vančetović

Genetička dobit od selekcije na bazi HS potomstava kod dve sintetičke populacije kukuruza

 

D. Đokić, S. Lomović, M. Milovanović i R. Ognjanović

Genotipske specifičnosti uticaja mase, koncentracije i količina azota u semenu na vitalnost ponika pšenice I. Akumulacija, raspodela i koncentracija azota u biljci

 

D. Đokić, S. Lomović, M. Milovanović i R. Ognjanović

Genotipske specifičnosti uticaja mase, koncentracije i količina azota u semenu na vitalnost ponika pšenice II. Efikasnost mase i azota semena

 

D. Đokić, S. Lomović, M. Milovanović i R. Ognjanović

Genotipske specifičnosti uticaja mase, koncentracije i količina azota u semenu na vitalnost ponika pšenice III. Usvajanje azota zrna, njegova akumulacija i iskorišćavanje u biljci

 

D. Đokić, M. Kostić, S. Lomović i M. Jelić

Neki pokazatelji efikasnosti mineralne ishrane pšenice kao selekcioni kriterijum

 

D. Đokić, M. Kostić, S. Lomović i M. Milovanović

Efikasnost ishrane pšenice azotom kao genotipska karakteristika

 

D. Đokić, M. Kostić, S. Lomović i M. Milovanović

Neke fiziološke osnove za genotipsko poboljšanje sadržaja proteina u zrnu pšenice

 

J. Đorđević i M. Ivanović

Fenotipske korelacije za otpornost stabla prema poleganju kod (B14 x K134)F2 sintetičke populacije kukuruza (Zea mays L.)

 

R. Đorđević, Z. Marković, V. Pešić i I. Đinović

Uticaj "afila" gena na formiranje mahuna graška Pisum sativum L.

 

Matilda Đukić i Dragica Obratov

Genetska specifičnost morfoloških svojstava half-sib potomstva hibridnog platana

 

Ž. Gajić i A.E. Bell

Efikasnost unutar linijske i recipročno povratne selekcije pri unapređenju telesne mase i plodnosti  miševa

 

M. Grbić

Osobine rasta ožiljenica sibirskog bresta (Ulmus pumila L.) sa patuljastih matičnih biljaka

 

Branislava Grbović i Biljana Nikolić

Razlike između šest sorti belog duda (Morus alba, L.) razmnožavanih in vitro

 

Đ. Gvozdenović, Marija Kraljević-Balalić, I. Mihaljev i A. Takač

Komponente genetičke varijanse za dužinu i širinu ploda hibrida paprike (Capsicum annuum L.)

 

V. Guzina, S. Orlović i G. Abramović

Procena pogodnosti korišćenja nekih karakteristika lista crnih topola (selekcija Aigeiros) za identifikaciju sorti

 

V. Isajev, A. Tucović i Mirjana Šijačić

Dostignuća u oplemenjivanju crnog bora (Pinus nigra Am.) u Srbiji

 

Đ. Jocković, J.R. Vilcox, H.J. Xu, Milica Hrustić i M. Stojaković

Rekurentna selekcija soje: međuzavisnosti heritabilnost sadržaja proteina i komponenti prinosa u "pro" populaciji soje

 

J. Joksimović, R. Marinković i M. Mihaljčević

Kombinacione sposobnosti za komponente prinosa F1 hibrida suncokreta (Helianthus annuus L.)

 

B. Jovanović, S. Prodanović i D. Stevanović

Uticaj različite germplazme na nasleđivanje osobina plodova hibrida paprike F1 generacije

 

D. Knežević

Identifikacija sorti prema kompoziciji Gli- alela

 

D. Knežević

Varijabilnost alela Gld lokusa kod jugoslovenskih sorti ozime pšenice (Triticum aestivum L.)

 

D. Knežević, Mirjana Menkovska i Dragica Zorić

Variranje alela na Gli lokusima kod nekih makedonskih sorti pšenice

 

D. Knežević, M. Pavlović, Marija Kraljević-Balalić i Veselinka Zečević

Genetička analiza površine lista zastavičara kod pšenice (Triticum aestivum L.)

 

D. Knežević, Ljiljana Vapa i Aleksandra Yurievna Novoselskaya

Polimorfnost Gli-D1 IGH-D2 lokusa pšenice (Triticum aestivum L.)

 

Nada Korać i P. Cindrić

MILA - novi kultivar vinove loze za bela vina

 

L. Kovačev, N. Čačić i Snežana Mezei

Polu sib test kros rekurentna selekcija multigermnih tetraploidnih oprašivača šećerne repe

 

B. Kovačević, Snežana Mezei i Marija Kraljević-Balalić

Kalusogeneza kod šećerne repe (Beta vulgaris L.)

 

Mirjana Kraljević-Balalić, M. Dimitrijević i Sofija Petrović

Analiza kombinacionih sposobnosti za broj zrna pšenice

 

M. Kuburović, M. Pavlović i D. Knežević

Kombinacione sposobnosti i efekti gena za volumen korena pšenice

 

Nevenka Kuprešanin i Snežana Mezei

Indukcija haploidnog kalusa kod šećerne repe

 

D. Latinović, Lj. Lazarević, P. Stojić, G. Trifunović i M. Katić

Mogućnosti primene restriktivnih selekcijskih indeksa u populacijama mlečnih goveda

 

Vera Lavadinović, V. Isajev

Fenotipsko-fiziološka varijabilnost 29 provenijencija duglazije (Pseudotsuga laxifolia Britt.) u test kulturama

 

Lj. Lazarević

Mogućnosti i ograničenja u genetskom unapređenju osobina mlečnosti u goveda

 

Lj. Lazarević, D. Latinović, G. Trifunović, M. Katić i P. Stojić

Uticaj nivoa mlečnosti na genetsku varijabilnost

 

Z. Lugić, Kosana Kostantinov 2, m. Ivanović 2, i g. Milošević

Varijabilnost crvene deteline (Trifolium pratense L.) na proces biološke fiksacije azota

 

Milomirka Madić i M. Pavlović

Nasleđivanje visine stabla kod hibrida ječma (Hordeum vulgare L.)

 

R. Marinković, D. Škorić, J. Crnobarac i N. Dušanić

Korelacije i analiza koeficijenta putanje kod ricinusa (Ricinus communis L.)

 

Ljiljana Merkulov, Jadranka Ivezić i Marija Kraljević-Balalić

Međuzavisnost morfo-anatomskih osobina vršnog lista i nekih komponenti prinosa pšenice

 

Danica Mićanović, Zora Sarić, M. Sarić i V. Mitrović

Genetska varijabilnost pšenice u stvaranju prirodnih asocijacija sa slobodnim diazotrofima

 

N. Mišić R. Cerović i Gordana Đurić

Atrofija semenih zametaka u cvetovima sa prekinutim razvojem kod šljive (P. domestica L.)

 

N. Mićić, R. Cerović i Gordana Đurić

Deformiteti plodnika šljive uslovljeni nepravilnim srastanjem karpele

 

M. Mihaljčević

Nuklearni i ekstranuklearni faktori kao uzrok žute pegavosti listova suncokreta (H. annum L.)

 

I. Mihaljev, Marija Kraljević-Balalić, P. Dorić i S. Petrović

Buduće potrebe za promene koncepcije i metoda oplemenjivanja biljaka

 

M. Milutinović, Ružica Džamić, L. Avramov, D. Nikolić i M. Nikolić

Varijabilnost prinosa grožđa i sadržaja pigmenata hloroplasta u hibridnom potomstvu vinove loze (Vitis sp.)

 

M. Milutinović, Gordana Šurlan-Momirović, N. Ralević, Ivana Ralević i Vera Rakonjac

Multivarijaciona analiza nekih populacija divlje trešnje (Prunus avium L.)

 

A.M. Mirković, R.R. Todorović, P.D. Mišić, Z.V. Pavlović i N.G. Zec

Selekcija oraha Juglans regia L. u Srbiji

 

M. Mitrović

Ekonomske i biološke karakteristike nekih selekcija oraha

 

Nastasija Makovački, Snežana Mezei i L. Kovačev

Kompatibilnost hibrida žećerne repe i sojeva Azotobactera

 

S. Orlović, V. Guzina

Procena mogućnosti korišćenja anatomske građe liske u selekciji Topola

 

Zorica Pajić i M. Babić

Hibridi kukuruza kokičara – stvaranje i iskorišćavanje

 

M. Pavlović, M. Kuburović, D. Knežević i Veselinka Zečević

Genetički efekti i nasleđivanje debljine sklerenhimskog sloja u stablu pšenice

 

V. Pešić i Dragica Zorić

Nasleđivanje visine stabla kod hibrida pšenice u F3 i F4 generaciji

 

R. Petrović, N. Delić i M. Vidaković

Ocena divergencije donora nosilaca poželjnih alela za popravku prinosa zrna nekih ZP hibrida kukuruza (Zea mays L.)

 

Sofija Petrović, Marija Kraljević-Balalić i M. Dimitrijević

Način nasleđivanja i komponente fenotipske varijabilnosti za broj zrna po klasu pšenice

 

M.M. Petrović, R. Lazarević, Lj. Lazarević S. Vasović, B. Miščević, S. Aleksić, D. Radosavljević

Genetski parametri osobina telesne razvijenosti ženskog podmlatka goveda

 

Lj. Prijić, Mirjana Jovanović i M. Mladenović

Primena genetičke muške sterilnosti u selekciji soje

 

Vera Rakonjac, T. Živanović i D. Nikolić

Komponente varijabilnosti i heritabilnost za neke osobine ploda trešnje

 

G. Saratlić, K. Konstantinov, I. Verešbaranji, Snežana Mladenović, J. Dumanović, B. Kerečki

Proučavanje genetičke kontrole kvaliteta lipida u zrnu kukuruza

 

P. Sklenar, J. Boćanski i Marija Kraljević-Balalić

Način nasleđivanja površine lista kod kukuruza (Zea mays L.)

 

A. Stančević i M. Nikolić

ČARNA - nova sorta trešnje

 

M. Stanisavljević

In vitro klijanje i čuvanje polena kupine

 

Tatjana Stevanović Janežić i V. Isajev

Upoznavanje genetske sličnosti geografski izolovanih populacija omorike na osnovu terpenskog sastava isparljivog ulja četina

 

M. Stojaković, D. Jocković, J. Boćanski, G. Bekavac i R. Popov

Analiza kombinacionih sposobnosti za prinos zrna kukuruza (Zea mays L.)

 

Vidosava Šećerov-Fišer

Način nasleđivanja visine biljaka ukrasnih suncokreta

 

Gordana Šurlan-Momirović, Zorica Tomić, Ivana Ralević i N. Ralević

Procena germplazme kolekcije Agrostis stolonifera multivarijacionom analizom

 

Zorica Tomić

Oplemenjivanje italijanskog ljulja (Lolium multiflorum Lam.) udvajanjem hromozoma

 

Z. Tomović i S. Orlović

Varijabilnosti naslednost morfoloških parametara lista klonova topola sekcije leuce

 

G. Trifunović, Lj. Lazarević , D. Latinović, P. Stojić i M. Katić

Uticaj nivoa gena holštajn-frizijske rase na osobine mlečnosti i plodnosti krava crno-belih goveda

 

B. Trifunović, V. Trifunović, Gordana Radović i D. Jelovac

Selekcioni progres i divergentnost domaćih sintetičkih populacija kukuruza (Zea mays L.)

 

A. Tucaković i V. Isajev

Poliploidni kompleksi, diploidizacija poliploida i oplemenjivanje drveća i žbunja

 

A. Tucović, V. Isajev i Mirjana Šijačić

Varijabilnost pola i njen značaj za oplemenjivanje domaće crne topole (Populus nigra L.)

 

A. Tucović, V. Isajev i Mirjana Šijačić

Masovna i individualna selekcija munike (Pinus heldreichi Christ.) u Srbiji

 

Ljiljana Vapa, S. Denčić, Erika Rakk-Šoltes i S. Kevrešan

RFLP u lokusima Glu-1I tehnološki kvalitet sorti pšenice

 

Mirjana Vasić

Genetska analiza broja zrna po biljci u ukrštanjima kod belih pasulja

 

Dragana Vasić, Ana Marjanović i B. Dozet

"IN VITRO" selekcija suncokreta (Helianthus annuus L.) na otpornost prema Diaporthe (Phomopsis) helianthi Munt.-Cvet. i dr.

 

Dragica Vilotić, Mirjana Šijačić i V. Isajev

Varijabilnost makroskopskih i mikroskopskih karakteristika dvogodišnjih sadnica 26 half sib familija planinskog javora (Acer heldreichii Orph.)

 

Jasmina Zdravković, Z. Marković, M. Damjanović i M. Zdravković

Nasleđivanje debljine perikarpa plodova paradajza (Lycopersicon escukntum Mill.)

 

Veselinka Zečević, M. Pavlović, D. Knežević i B. Vulić

Genetička analiza produktivnog bokorenja kod pšenice

 

Marija Zlokolica i I. Gerić

Izozimska varijabilnost u jugoslovenskim kolekcijama kukuruza

 

T. Živanović, Gordana Šurlan-Momirović, Ivana Ralević i N. Ralević

Numerička klasifikacija ZPSin populacija kukuruza baziranih na kvantitativnim osobinama

 

 

Simpozijum 5. POPULACIONA I EVOLUCIONA GENETIKA

 

N. Tucić

Populaciona genetika i dve velike sinteze moderne biologije

 

I. Aleksić

Genetičke komponente varijabilnost i veličine i oblika tokom ontogenije kod guštera Lacerta oxycephala

 

S. Avramov i Branka Tucić

Kvantitativna genetika juvenilnih osobina kod Iris pumila struktura fenotipske varijabilnost

 

C. Cekuš

Prisustvo rupice na bradi i na licu u uzorku iz okoline Subotice

 

G. Cekuš

Varijacija ivice kose na čelu u uzorcima iz severne Srbije

 

Jelka Crnobrnja-Isailović i I. Aleksić

Genetička strukturiranost populacija tri vrste guštera (Sauria: Lacertidae) na području Skadarskog jezera

 

Dragana Cvetković i N. Tucić

Efekat osnivača i multivarijantna selekcija

 

Ivana Gliksman

Kvantitativno-genetička osnova povećanja dužine života kod pasuljevog žiška (Acenlhoscelides obtectus)

 

V. Kekić, Sofija Pavković-Lučić, Aleksandra Čvoro i N. Milošević

Seksualna selekcija i veličina tela kod Drosophila melanogaster

 

D. Knežević, D. Marinković, Lj. Agramović

Populaciono genetička analiza levorukosti kod stanovništva Prokuplja

 

Stanislava Mikuljanac i O. Stojković

Kvantitativno genetička analiza komponenti adaptivne vrednosti kod dve laboratorijske populacije pasuljevog žiška (Acanthoscelides obtectus)

 

Mirjana Milanović i M. Anđelković

Varijabilnost nekih komponenti adaptivne vrednosti različitih genotipova Amy lokusa kod Drosophila subobscura u zavisnosti od sastava supstrata

 

Dragana Milanović i Sofija Karaulić

Mehanizmi održavanja genetičke varijabilnosti za izbor domaćina kod pasuljevog žiška (Acanthoscelides obteclus)

 

N. Milošević, V. Kekić, Sofija Pavković-Lučić i Aleksandra Čvoro

Učenje kod Drosophila melanogaster uticaj na genetičku strukturu

 

Milica Milošević, Z. Magić, Č. Radojičić i D. Marinković

Uticaj traume na promenu koncentracije haptoglobulina i a2 makroglobulina u AO i DA inbredovanim sojevima pacova

 

V. Novosel

Populaciono-genetička ispitivanja recesivnih karakteristika u ljudskim populacijama "izolatima" u Crnoj Gori

 

D. Paunović, R. Simonović, I. Stolić i M. Dokić

Izračunavanje faktora rizika za nastanak bolesti kalema protiv domaćina izazvane transfuzijom

 

B.P. Pavlović

Potencijal broja ćelija i veličina sistema jedinke i populacije

 

R. Simonović, D. Paunović, I. Stolić i V.D. Miletić

Neslučajne asocijacije gena HLA A i HLA B lokusa kod stanovništva Srbije

 

M. Stamenković-Radak, J.B. Clark i M. Kid Well

Proctolaelaps regalis kao mogući vektor u horizontalnom transferu P elementa između vrsta Drosophila species

 

Snežana Stanić i D. Marinković

Selekcija za različito vreme do prvog parenja kod Drosophila melanogaster

 

S. Stojanović i Jovanka Stojanović

Geni virulentnosti u populaciji Erysiphe graminis f. sp. tritici

 

Vesna Stojiljković

Individualna varijabilnost aktivnosti amilaze kod Drosophila subobscura

 

O. Stojković

Efekti višegeneracijske selekcije za nisku i visoku gustinu larvi na osobine životnog ciklusa pasuljevog žiška (Acanlhoscelides Obtectus)

 

Darka Šešlija i D. Blagojević

Efekti antioksidanata na dugovečnost kod kratko- i dugo- živećih linija pasuljevog žiška (Acanthoscelides obleclus)

 

Tatjana Terzić i M. Anđelković

Uticaj reproduktivnog uspeha jedinki Drosophila subobscura homozigotnih za S ili B alel Amy-lokusa na preživljavanje potomaka u zavisnosti od sastava supstrata

 

Branka Tucić i S. Avramov

Kvantitativna genetika juvenilnih osobina kod Iris pumila: materinski efekti

 

Ljiljana Vapa, Ivana Karanović, Dragana Radović, J. Purger i M. Bokorov

Genetička udaljenost između tri vrste roda Apodemus

 

G. Živanović, Mirjana Milanović i M. Anđelković

Povezanost kompleksnosti strukturnih tipova o hromozoma i stepena genetičkih opterećenja kod Drosophila suboboscura

 

Jelena Živanov-Čurlis i Estera Mrčarica

Efekat procesa starenja na genetičko opterećenje Drosophila melanogaster

 



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RETROSPEKTIVE RAZVOJA CITOGENETIKE

 

B. SOLDATOVIĆ

 

Veterinarski fakultet, Beograd

 

U radu su izneta najnovija saznanja iz oblasti opšte i animalne citogenetike i ukazno je na njihov fundamentalni i aplikativni značaj, kao i trend u daljem razvoju i mogućnostima primene u savremenim genetičkim istraživanjima. Retrospektiva razvoja ove naučne discipline praćena je kroz osmišljavanje, uvođenje i usavršavanje citogenetičkih tehnika i metoda, postignutih rezultata i njihove aplikacije u tumačenju filogenetskih odnosa, evolucije kariotipa do danas ispitivanih vrsta, bionominitoringu u funkciji očuvanja autentičnog genofonda biljnih i animalnih vrsta i zaštite životne sredine. U radu je takođe istaknut značaj citogenetičkih metoda kako u dijagnostici, tako i u preventivi pojave i distribucije genetički aberantnih formi u određenim populacijama. Razvoj i uvođenje informatike u citogenetiku sa postojanjem više od 10 megaprogramskih sistema, prilagođenih za detaljne analize kariotipa, u budućnosti obećava preciznu citogenetičku dijagnostiku, završetak izrade započetih genskih mapa, kao i sigurniju aplikaciju ove naučne discipline u biotehnologiji, a posebno u embriotehnologiji.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CITOGENETSKA ISTRAŽIVANjA INTERSPECIES HIBRIDA SUNCOKRETA (H. annum L. x H. occidentalis Riddelt)

 

Jovanka ATLAGIĆ

 

Institut za ratarstvo i povrtarstvo, Novi Sad

 

H.occidentalis je diploidna višegodišnja vrsta suncokreta čije su filogenetsko poreklo i genetska srodnost u odnosu na druge vrste roda Helianthus malo izučavane. U ovom radu je ispitivana mogućnost ukrštanja H. occidentalis i kulturnog suncokreta. Kod vrste i dobijenih F1 hibrida je analizirana mejoza acckokarmin metodom (Georgieva, 1976) i vitalnost polena bojenom metodom (Alexander, 1969). Iz ukrštanja kulturnog suncokreta i H. occidentalis dobijeno je tri hibridne kombinacije. Kod H. occidentalis mejoza je proticala uz nizak procenat nepravilnost tipa izbeglih i izostalih hromozoma. Hromozomski mostovi i fragmenti nisu detektovani. Parenje hromozoma u dijakinezi je bilo normalno (17 bivalenata). Vitalnost polena je bila visoka (90.81-97.68%). Kod F1 interspecies hibrida mejoza je proticala uz niz nepravilnosti. Prosečan broj bivalenata po mejotici je iznosio 13,39, a procenat mejocita sa bivalentima 82,35%. Pored bivalenata u dijakinezi su detektovani univalenti (9,19% mejocita) kao i multivalenti (8,46% mejocita). Izbegli hromozomi u metafazi I, izostali hromozomi u anafazi I i telofazi II su se pojavljivali u visokom procentu mejocita. Hromozomski mostovi i fragmenti su zabeleženi u 10,52% mejocita. Vitalnost polena kod F1 hibrida je bila niska (3,72 - 52,94%). Dobijeni rezultati pokazuju, da iako se radi o vrstama sa istim brojem hromozoma, postoje razlike u strukturi i hromozoma. To potvrđuje da se genom diploidnih višegodišnjih razlikuje od genoma jednogodišnjih vrsta. Pitanje je da li osnovni broj hromozoma 17 kod suncokreta čine jedan genom ili više genoma.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

DISTRIBUCIJA KONSTITUTIVNOG HETEROHROMOATINA I NUKLEOLUSNIH ORGANIZATORA KOD GUŠTERA IZ FAMILIJE LACERTIDAE (SAURIAJ)

 

Jelena BLAGOJEVIĆ i VUJOŠEVIĆ M.

 

Odeljenje za genetiku, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Familiju Lacertidae karakteriše kariotipska uniformnost. Skoro sve vrste imaju isti broj i morfologiju hromozoma, 36 akrocentričnih makrohromozoma i 2 mikrohoromozoma. Struktura hromozoma kod osam vrsta familije Lacertidae (Podarcis sicitla, P. muralis, Lacerta viridis, L. trilineata, L. melisellensis, L. taurica, L. agilis i Algyroides nigropunctatus) analizirana je na osnovu rasporeda i količine konstitutivnog heterohromatina i prisustva i lokacije nukleolusnih organizatora. Utvrđena je interspecijska varijabilnost u broju i položaju nukleolusnih organizatora. Prisustvo konstitutivnog heterohromina u centromernom regionu zajedničko je za sve vrste, dok terminalni i interkalarni konstitutivni heterohromatin karakteriše samo neke od njih. Filogenetski odnosi među vrstama razmotreni su u svetlu ovih razlika.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ OKSITOCINA NA MITOTSKU AKTIVNOST I POJAVU HROMOZOMSKIH ABERACIJA U KULTURAMA LIMFOCITA PERIFERNE KRVI ČOVEKA

 

N. ĐELIĆ 1, B. SOLDATOVIĆ 1 i M. ANĐELKOVIĆ 2

1 Katedra za biologiju, Veterinarski fakultet, Beograd
2 Katedra za genetiku, Biološki fakultet PMF, Beograd

 

Ispitivan je uticaj oksitocina (SyntocinonR) na pojavu strukturnih i numeričkih aberacija hromozoma u kulturama periferne krvi čoveka. Ispitane su četiri koncentracije oksitocina (0,01 lU/ml, 0,02 lU/ml, 0,05 lU/ml, i 0,1 IU/ml). Pored toga, korišćena je negativna i pozitivna kontrola. Od strukturnih aberacija praćena je pojava hromatidnih i hromozomskih prekida i gapova. Od numeričkih aberacija registrovana je pojava heteroploidnih i poliploidnih ćelija. U okviru ispitanih koncentracija, oksitocin nije doveo do statički značajnih odstupanja u pojavi strukturnih i numeričkih aberacija u odnosu na nivo kod negativne kontrole. Primena pozitivne kontrole (10 MNNG) dovodi do statistički značajnog povećanja pojave strukturnih aberacija, dok se nivo numeričkih aberacija ne menja značajno. Radi utvrđivanja eventualnih citotoksičnih efekata određen je mitotski indeks za svaku od eksperimentalnih koncentracija, negativnu i pozitivnu kontrolu. Pri tome, nije zabeleženo statistički značajno odstupanje u vrednostima mitotskog indeksa u odnosu na negativnu kontrolu. Prema tome, može se zaključiti da oksitocin nije ispoljio genotoksične efekte u okviru ispitanih koncentracija.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UČESTALOST PROMENA TIPA GAPA I PREKIDA NA HROMOZOMIMA RIBA VRSTE STIZIOSTEDION VOLGENSE (PERCIDEA) UHVAĆENIH NA NEKIM LOKALITETIMA DUNAVA


Svetlana FIŠTER i B. SOLDATOVIĆ

 

Veterinarski fakultet, Beograd

 

Prikazan je kariotip vrste Slizostedion volgenses (Percidao), tj, utvrđen je broj i morfologija hromozoma. Analizirana je učestalost strukturnih promena na hromozomima - tipa gapa i prekida, kod jedinki uhvaćenih na četiri lokaliteta Dunava: kod Beške, Zemuna, Višnjice i Grocke. Najviše srednje vrednosti za promene tipa gapa i prekida ustanovljene su na hromozomima riba uhvaćenih na lokalitetima Dunava, nizvodno od ušća Save i Beograda, kod Višnjice i kod Grocke. Dobijeni rezultati ukazuju na prisustvo genotoksičnih agenasa u vodi Dunava, a navedeni lokaliteti su označeni kao stalno ili povremeno genotoksički rizični.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RAZLIČITI ODGOVORI NA GENOTOKSIČAN AGENS U ZAVISNOSTI OD GENETIČKE KONSTITUCIJE

 

Drinka MERĆEP 1, A. ĐUJIĆ 2, Z. MAGIĆ 2 i M. SIMOVIĆ 2

 

1 Veterinarski fakultet, Beograd
2 Institut za medicinska istraživanja VMA, Beograd

 

Jonizujuće zračenje je kao nesumnjivi genotoksični agens podesno za upoređivanje odgovora različitih sojeva iste vrste životinja. Najmerodavniji biološki indikator za radijaciono oštećenje ćelije je prisustvo dicentričnin i "ring" hromozoma koji su pouzdan pokazatelj da je organizam ozračen. Soj miševa BALB/C je vrlo osetljiv, dok je CS7BL/6 rezistentniji na jonizujuće zračenje mereno sa LD50. Ovaj fenomen se može objasniti genetskim faktorima koji kontrolišu određene fiziološke funkcije što pretpostavlja postojanje genetske predispozicije za otpornost na radijacionu traumu. Eksperiment je izveden na miševima BALB/c koji su radiosenzibilni i kod kojih LD50/30 iznosi 5,98 Gy i soju miševa C57BL/6 koji je rezistentniji na gama zračenje i čije LD50/30 iznosi 8,308 Gy. Životinje su žrtvovane u različitim vremenskim intervalima posle ozračavanja i to prvog, četvrtog i desetog dana. Za svaki termin i od svakog soja upotrebljeno je po 6 životinja. Za dobijanje hromozoma korišćena je klasična citogenetska tehnika. Dobijeni rezultati idu u prilog činjenici da je bitan elemenat u odgovoru organizma njegova genetska konstitucija.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

DELOVANJE KOLHICINA NA NEKA KVANTITATIVNA SVOJSTVA ŠEĆERNE REPE

 

Snežana MEZEI, L. KOVAČEVIĆ i N. ČAČIĆ

 

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Rad na stvaranju triploidnih hibrida šećerne repe vezan je za prevođenje diploidnih genotipova na tetraploidni nivo. Indukovani poliploidi predstavljaju izvor nove genetske varijabilnosti. U selekciji šećerne repe multigermni tetraploidi dobijeni dejstvom kolhicina koriste se kao polinatori za sterilne diploide, a monogermni tetraploidi kao majčinske komponente za diploidne i tetraploidne multigermne populacije. Indukcija autotetraploida bazirana je na mutagenom delovanju kolhicina na niti deobnog vretena. Prilikom delovanja kolhicina na apikalne meristeme tendencija je da se što veći procenat izvornog genotipa prevede na tetraploidni nivo. Obzirom da se sve ćelije nisu nalazile u fazi aktivne mitotske deobe, određeni procenat ishodnog genotipa zadržao se na diploidnom nivou. Cilj rada je bio da se uporede ishodni diploidi i diploidi koji su bili u tretmanu sa kolhicinom, ali nisu promenili nivo ploidije. Takođe ustanoviti dali je kolhicin delovao samo na niti deobnog vretena ili i na kompleks gena koji su nosioci određenih kvantitativnih svojstava (prinos korena, sadržaj šećera, prinos polarizacionog i kristalnog šećera). Vodeni rastvor kolhicina nanet je na apikalne tačke rasta ispitivanih genotipova u uslovima staklenika. Citološka analiza urađena je aceto-karmin squash metodom. Za dalji rad ostavljeni su korenovi šećerne repe sa 36 i 18 hromozoma, koji su u sledećoj godini analizirani i odstranjene su sve biljke sa miksoploidnim tkivima iz ogleda. Rezultati istraživanja pokazuju da su ustanovljene značajne razlike u prinosu korena i prinosu kristalnog scdcra izmcdu ispitivanih genotipova, a takode i između izvornih diploidnih populacija, diploidnih populacija koje nisu prevedene na tetraploidni nivo i indukovanih autotetraploida. Za ostala ispitivana kvantitativna svojstva: sadržaj šećera, K, Na, alfa-N i prinos polarizacionog šećera utvrđene razlike nisu bile statistički opravdane.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

METOD IZRADE NUMERIČKIH ETALONA KARIOTIPA

 

B.P. PAVLOVIĆ

 

Institut za šumarstvo, Beograd

 

Količina hromosomskog materijala spojena sa centromerom nazvana je „centromerno opterećenje“ (CO). Dužina hromosoma je predložena kao moguća mjera za unutarkariotioski poređenje centromernih opterećenja. Baza za izračunavanje indeksa cetromernih opterećenja je aritmetička sredina dužina hromosoma u kariotipu (specifično centormerno opterećenje – SCO). Ove indeksne vrijednosti mogu da se koriste u poređenjima kariotipova. Razvijen je maematičko-statistički metod za analizu kariotipa. Kompleks, mjereni dužina, izračunavanih pojedinačnih analitičkih i sloćenih pokazatelja, koji predstavlja kvantitativno stanje jedne tipične hromosomske garniture (kariotipa), nazvan je numerički etalon kariotipa. Dodatno se računaju tri podskupa indeksnih vrijednosti na bazama aritmetičkih sredina dužina (dugih, kratkih, ili, i dugih i kratkih) krakova. Ovi podskupovi podataka predstavljaju simulirane kariotipove, nastale delecijama svih kratkih, ili svih dugih krakova, ili centričnim fisijama svih hromosoma. Simboli i formule za mjerenje i izračunavanje količine se daju u formi algebarskih tabela numeričkog etalona kariotipa.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NUMERIČKI ETALONI KARIOTIPOVA Erinaceus europaeus europaeus

 

B.P. PAVLOVIĆ

 

Institut za šumarstvo, Beograd

 

Mjereni su hromosomi na publikovanim kariotipovima mužjaka i ženke podvrste Erinaceus europaeus europaeus (Folio 52 in An atlas of mammalian chromosomes). Podaci su korišćeni za kariometrijsku analizu predstavljenu sa dva skupa tabela - numerički etaloni kariotipova. Odnos dužina (W) najdužeg i najkraćeg hromosoma u kariotipu mužjaka (W=8,4194) manji je nego u kariotipu ženke (W=9,7079). Indeksi centromernih opterećenja (H) u kariotipu mužjaka opadaju od H1 = 1,7988 do H48=0,2136 (Y-hromosom nije najkraći), a u kariotipu ženke od H1 = 1,8744 do H48=0,1931. Jedinične indeksne vrijednosti (H=l) locirane su između H24 i H25 (mužjak), ili H26 i H27 (ženka). Korelacije dužina sestrinskih hromatida u kariotipu su visoke, mužjak i ženka r=0,987 i ρ=0,986. Komponenta varijacije H-indeksa (mužjak sH=0,577 i ženka sH=0,573) su veće nego za duge krakove, L-indeksi (mužjak sL=0,438 i ženka sL =0,426), ili za kratke krakove, K-indeksi (mužjak sK=0,262 i ženka sK =0,255). Simulacije delecija, svih kratkih, ili svih dugih krakova, rezultirale su porastom iznosa odgovarajućih komponenti varijacije, kao i u simulacijama centričnih fisija svih hromosoma.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ODNOS KOMPONENTI VARIJACIJE UNUTAR KARIOTIPA SISARA I RIBA: INDEKSI PARCIJALNOG CENTROMERNOG OPTEREĆENjA KRAKOVA I INDEKSI CENTROMERNOG OPTEREĆENjA

 

B. PAVLOVIĆ, i Nevenka PAVLOVIĆ

 

Prirodno-matematički fakultet, Sarajevo

 

Svaki nepublikovani numerički etalon za 270 kariotipova sisara i riba (B. Pavlović) sadrži vrijednosti odnosa (PsA=sA/sH) varijacije hromozomskih krakova prema varijaciji hromosoma u jedinicama srednjih dužina hromosoma za svaki kariotip. Pokazatelji (PsA) su poređeni između taksona i povezivani su 2n. Aritmetička srednja vrednost PsA je 1,005 ili 1,434 za riblje, a 0,939 za sisarske kariotipove. Rasponi pokazatelja su od 0,530 do 2,985, ili 0,636 do 2,985 (Pisces), 0,530 do 2,183 (Mammalia). Postoji nekoliko vrijednosti 2n sa širokim rasponom odnosa PSA. Specifične veze 2n, PSA pokazuju se kod zastupljenih rodova sisara.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HROMOZOMSKI KOMPLEMENTI NEKIH RIBA IZ FAMILIJE CYPRINIDAE

 

Slavica SIMOVIĆ i G. MARKOVIĆ

 

Agronomski fakultet, Čačak

 

Istraženi su hromozomski komplementi pet ribljih vrsta koje pripadaju familiji Cyprinidae. Ove vrste su česte u vodama Dunavskog sliva. Naša istraživanja su pokazala da diploidne hromozomske garniture analiziranih vrsta sadrže 50 hromozoma (2n = 50): Chondrostoma nasus od 15 metacentričnih, 15 submetacentričnih, 12 subtelocentričnih i 8 telocentričnih; Alburnoides bipunctatus od 8 pan metacentričnih, 7 pari submetacentričnih, 6 pari subtelocentričnih i 4 para telocentričnih; Blicca bjoerkna od 6 pari metacentričnih, 7 pari submetracentričnih, 6 pari subtelocentričnih i 6 pari telocentričnih; Abramis sapa od 12 metacentričnih, 14 submetacentričnih, 10 subtelocentričnih i 14 telocentričnih i Ambramis ballems, 15 metacentričnih, 10 submetacentričnih, 12 subtelocentričnih i 13 telocentričnih hromozoma. Utvrđene su izvesne razlike u odnosu na podatke iz literature u pogledu morfoloških tipova hromozoma za pojedine vrste.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VELIKI AKROCENTRICNI HROMOZOM IZ PRVOG PARA AUTOZOMA PRIRODNIH POPULACIJA, VRSTE Mus musculus, Linne 1758

 

Z. STANIMIROVIĆ 1, Mirjana VUČINIĆ 2, B. SOLDATOVIĆ E. HERZOG 1

1 Veterinarski fakultet, Beograd
2 Poljoprivredni fakultet, Beograd - Zemun

 

U radu su prikazani rezultati ispitivanja hromozomskog polimorfizma prirodnih populacija Mas musculus. Ispitivanja su obavljena na pet različitih lokaliteta (Ševarice, Glušci, Lipolist, Bogatić, Sremska Mitrovica) u severozapadnoj Srbiji oko Save i Dunava. Osim uočenog hromozomskog polimorfizma Robertsonovog tipa, kod većeg broja ispitivanih životinja utvrđeno je prisustvo jednog velikog akrocentričnog hromozoma iz prvog para autozoma koji je bio uobičajan za kariotip miša. Primenom odgovarajućih citogenetičkih metoda utvrđeno je da izmenjeni hromozomi nose dve umetnute insercije. One su bile smeštene u ICs i IE regionu. Na osnovu dobijenih rezultata analize kariotipa miša i literaturnih podataka može se zaključiti da je zapaženi akrocentrični hromozom rezultat adaptacije miša na povećano zagađenje životne sredine agrohemijskim i industrijskim polutantima na ispitivanim lokalitetima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CITOGENETIČKE KARAKTERISTIKE REGENERANATA DOBIJENIH IZ ANTERA PŠENICE (Triticum aestivum L.) GAJENIH U KULTURI IN VITRO

 

S. ŠESEK


Institut za ratarstvo i povrtarstvo, Novi Sad

 

Citogenetičke analize su izvršene kod 189 zelenih regeneranata dobijenih iz antera Triticum aestivum L. gajenih u kulturi in vitro. Haploidan broj hromozoma u somatskim ćelijama (2n = 3X = 21) imalo je 49,2% ispitanih regeneranata, dok je diploidan broj hromozoma (2n = 6X = 42) imalo 41,3 % regeneranata, što znači da su 90,5 % zelenih regeneranata bili ili polihaploidi ili heksaploidi. Haploaneuploidi, tj, polihaploidi sa 2n = 19, 20 i 23 hromozoma, pojavili su se u frekvenciji od 2,1%, dok je frekvencija diploaneuploida (heksaploidi sa 2n = 40, 41, 43 ili 44 hromozoma) bila 4,2%. Poliploida je pronađeno svega 2, i to: jedan sa 2n = 8X = 56 i jedan sa 2n = 9X = 63 hromozoma, što je iznosilo 1,1% od ukupnog broja analiziranih regeneranata. Broj miksoploida, odnosno broj regeneranata kod kojih je utvrđeno prisustvo ćelija i sa haploidmm i sa idploidnim brojem hromozoma je bio 2,1%.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HROMOZOMI ŽABA IZ FAMILIJE RANIDAE (ANURA, AMPHIBIA) UPOREDNA ANALIZA

 

N. TANIĆ, Olivera SPASIĆ, Jelena BLAGOJEVIĆ i M. VUJOŠEVIĆ

 

Odeljenje za genetiku, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Poredani su hromozomi nekoliko vrsta roda Rana (Anura, Amphibia) sa različitih lokaliteta na osnovu broja i položaja nukleolusnih organizatora (NOR) i u odnosu na količinu i distribuciju konstitutivnog heterohromatina. Ispitivane vrste poseduju idcntičan broj hromozoma (2n-26) sa različitom morfologijom kariotipova. Utvrđen je polimorfizam u broju i položaju NOR-a na hromozomima i varijabilnost u distribuciji i veličini C-traka. Konstitutivni heterohromatin najčešće je prisutan u centromernom i telomernom regionu, a retko je lociran interkalarno. Kod većine vrsta NOR je lociran na jednom paru malih submetacentričnih hromozoma.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

„ROSOL“ KAO MOGUĆI INDUKTOR NUMERIČKIH HROMOZOMSKIH ABERACIJA POLIPLOIDNOG TIPA

 

Marijana VUČINIĆ 1, Z. STANIMIROVIĆ 2, B. SOLDATOVIĆ 2

 

1 Poljoprivredni fakultet, Beograd - Zemun

2 Veterinarski fakultet, Beograd

 

Rosol ("VZ - Zemun") je antikoagulantni rodenticid, koji kao aktivni princip u svome sastavu sadrži varfarin-natrijum. U radu je ispitivan uticaj ovog sredstva na nastanak citogenetičkih promena mejotskih ćelija semenki laboratorijskog miša pri sedmodnevnom intragastričnom tretmanu u dozi od 0,13 mg varfarin-natrijum/kg telesne mase. Pored sposobnosti indukcije strukturnih hromozomskih aberacija, utvrđeno je da Rosol indukuje i nastanak numeričkih aberacija poliploidnog tipa kod
posmatrane vrste ćelija. Dobijeni rezultati značajno doprinose tumačenju dejstva antikoagulantnih rodenticida, a između ostalog i opravdavanju pojave rezistentnosti na ovu vrstu sredstava.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

INTERPOPULACIONI POLIMORFIZAM B-HROMOZOMA KOD ŠUMSKOG MIŠA, APODEMUS FLAVICOLLIS (MAMMALIA, RODENTIA)

 

M. VUJOŠEVIĆ i Jelena BLAGOJEVIĆ

 

Odeljenje za genetiku, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Populacija žutogrlog Šumskog miša, Apodemus flavicollis, odlikuje se čestim prisustvom B-hromozoma. Uzorci sa devet lokaliteta (ukupno 689 životinja) upoređeni su u pogledu prisustva B-hromozoma. U svim uzorcima sem u jednom bile su prisutne jedinke sa B-hromozomima (1-5 B-hromozoma) u signifikatno različitim frekvencama (0.11 do 0.64). Ustanovljeno je da značajnog razlika u frekvencama jedinki sa B-hromozomima nije zavisna od tipa staništa, nadmorske visine niti pola. Signifikantne razlike u frekvenci jedinki sa B-hromozomima uzrokovane su vremenom ulova i uzrasnom kategorijom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HROMOZOMSKE ABERICIJE OTKRIVENE CORDOCENTEZOM

 

Slavenka ADŽIĆ 1, Stefanija MARKOVIĆ 2, D. PLEĆAŠ 2 N. RADUNOVIĆ 2 i Z. PILIĆ 2

 

1 Institut za ginekologiju i akušerstvo, Beograd

2 Institut za ginekologiju i akušerstvo KCS, Beograd

 

U prenatalnoj dijagnozi, pored drugih metoda, koje se primenjuju u Institutu za ginekologiju i akušerstvo, KCS, korišćena je i kordocenteza. Indikacije za prenatalnu dijagnozu su bile: starost trudnica, (od 36 - 47 godina) i malformacije fetusa, zastoj intrauterinog rasta ploda, kao i poremećen tok trudnoće (oligoamnion, hidroamnion) otkriveni ultrazvučnom dijagnostikom pri kontrolnom pregledu trudnica. U 173 trudnice starije dobi, otkrivena je 21 hromozomska abericija (12,4 %). U 88 trudnica kod kojih su ultrazvukom utvrđeni gore pomenuti poremećaji, otkriveno je 13 hromozomskih abericija (14,77%). U svim slučajevima abnormalnog kariotipa izvršen je prekid trudnoće.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETOKSIKOLOŠKA KARAKTERIZACIJA IVERMEKTINA I PRAZIKVANTELA U IN VITRO USLOVIMA

 

Nevenka ALEKSIĆ

 

Veterinarski fakultet, Beograd

 

Ispitivanjem su obuhvaćeni efekti antiparazitika ivermektin i prazikvantel u kulturi PHA-stimulisanih humanih limfocita. Evalucija njihovih genotoksičnih efekata obavljena je određivanjem frekvencije razmene sestrinskih hromatida (SCE). U našem test sistemu oba antihelmintika su ispoljila genotoksične efekte pri određenim koncentracijama koje su primenjene. Ivermektin je ispitivan u koncentracijama 0.15, 0.30, 0.60.1,20 i 2,40 ug/ml. Statistički značajno povećanje frekvencije SCE ispoljio je u koncentracijama većim od 0.15/ug/ml. Prazikvantel je dodavan kulturama u količini 2.84, 5,68, 11.36, 22.72 i 45.44 /ug/ml podloge. Statistički signifikantno ved broj razmena sestrinskih hromatida izazvao je u dozama 2.84, 5.68 i 11.36 /ug/ml; u većim dozama blokirao je mitozu.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CEFALOMETRIJSKA ANALIZA OSOBA SA KLINEFEKTEROVIM SINDROMOM

 

M. BABIĆ i M. MICIĆ

 

Institut za biologiju i humanu genetiku, Stomatološki fakultet, Beograd

 

Poremećaji u broju ponih hromozoma utiču na kranijalni rast kao i na oblik i poziciju kraniofacijalih struktura. Analizirano je 28 odraslih osoba sa Klinefelterovim sindromom i upoređeno sa kontrolnom grupom. Linearna i angularna merenja su urađena kod svih osoba sa lateralnog cefalograma pod istim uslovima. Ustanovljeno je da postoji smanjene kraniofacijalnog rasta kao i specifična morfologija glave kod osoba sa viškom X hromozoma. Posebno je analiziran uticaj viška hromozoma na rast kranijalne baze, visinu lica, maksilu, mandibulu i intermaksilarne odnose. Diskutovan je efekat disbalansa seks hromozoma na kraniofacijalne strukture.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

STEPEN GENETIČKE HOMOZIGOTNOSTI KOD DUŠEVNO OBOLELIH I ZDRAVIH OSOBA STANOVIŠTA PRIŠTINE I OKOLINE

 

S. BRANKOVIĆ i G. SAVIĆ

 

Prirodno-matematički fakultet, Priština

 

U radu su prikazani rezultati istraživanja 29 fenotipskih sistema, različitih regiona čoveka. Istraživanjima su obuhvaćene duševno obolele i zdrave osobe različitog životnog doba, starosti, pola i nacionalnosti. Rezultati istraživanja recesivnih varijanti fenotipskih osobina ukazuju na uvećani stepen genetičke homozigotnosti kod nervno obolelih osoba (prosečno 8,8 HRO), u odnosu na uzorak zdravih osoba srpske (6,5) i albanske (6,2) nacionalnosti. Uočena je i značajna razlika u pogledu tipa varijabilnosti homozigotno recesivnih morfofizioloških osobina u uzorku nervno obolelih, u odnosu na kontrolne grupe ispitanika. Veda procentualna učestalost ovih osobina utvrđena je za 8 do 29 HRO kod duševno obolelih osoba. Uvećan stepen genetičke homozigotnosti sugeriše mogućnost da genetička opterećenja mogu biti uzrok poremećaja koji vode dispoziciji za podleganje odgovarajućim bolestima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA ANALIZA IDIOPATSKE FOKALNE DISTONIJE

Dragana CVETKOVIĆ 1, Marina STOJANOVIĆ 2, V. KOSTIĆ 2

1 Biološki fakultet, PMF, Beograd
2 Institut za neurologiju UKC, Beograd

 

Mada je genetički aspekt generalizovane ITD (idiopatske torzione distonije) predmet intenzivnih istraživanja, o načinu nasleđivanja fokalne distonije postoji malo podataka. U ovom radu analizirana su 43 probanda sa različitim formama fokalne distonije (blefarospazam, tortikolis, grafospazam) i 168 od 179 živih rođaka roditelja, brade i sestara i dece. Deset indeks slučajeva imalo je obolele rođake u jednoj ili dve generacije. Rezultati segregacione analize ukazuju na autozomnodominantno nasleđivanje sa nepotpunom penetrabilnošću.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTVRĐIVANjE STEPENA GENETIČKE HOMOZIGOTNOSTI KOD BOLESNIKA SA UROĐENOM DISPLAZIJOM KUKA I U KONTROLNOM UZORKU ŠKOLSKE DECE BEOGRADA

 

Suzana CVJETIČANIN i D. MARINKOVIĆ

 

Biološki fakultet, Beograd

 

Polazeći od činjenice da je urođena displazija kuka genetički determinisana, pretpostavili smo da uvećana homozigotnost i smanjena varijabilnost kod obolelih mogu biti u korelaciji sa pojavom ovog oboljenja. Uzimajući u obzir iskustvo brojnih istraživača koji su proučavali prirodu nasleđivanja niza mono i oligogenski determinisanih kvalitativnih osobina kod ljudi, za cilj rada smo postavili utvrđivanje stepena genetičke homozigotnosti putem prisustva "homozigotno-recesivnih osobina" ("HRO-TEST"). Poređenjem zastupljenosti 21 HRO u kontrolnom uzorku (N=200) i u grupi obolelih (N=93), nađeno je da prosečan broj HRO iznosi, respektivno, 5,2 i 7,1 + .1. Čak 17 ovakvih osobina pokazuje uvećanu prisutnost kod bolesnika sa UDK, Sto se manifestuje i u odnosu na različite grupe ispitanika (npr. u odnosu na pol, levorukost i si.). Uzorak ispitanika sa lakim stepenom oboljenja (displazije, subluksacije) pokazuje manju prosečnu vrednost HRO od ispitanika sa najtežim stepenom oboljenja (luksacije), što ide u prilog pretpostavci da se remećenjem genetičko-fiziološke homeostaze stvara povoljna podloga za ispoljavanje ove bolesti. Utvrđivanje korelacije za ispitivane osobine kose i šake ukazalo je na postojanje specifičnih korelacija kod dva proučavana uzorka ispitanika i da su neki kombinovani fenotipovi češće nego što se to moglo očekivati na osnovu slučajnihkombinacija. Utvrđena je i smanjena varijabilnost za ispitivane funkcionalne osobine šake u grupi obolelih ispitanika, u odnosu na kontrolni uzorak.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VISOKA UČESTALOST TAČKASTIH MUTACIJA NA H-ras GENIMA U DVA TIPA TUMORA GLAVE I VRATA

 

N. DEDOVIĆ 1, J. MILAŠIN 2, V. PETROVIĆ 3, G. STAMENKOVIĆ 1, M.

GAVRIĆ 3, Z. NIKOLIĆ 3

 

1 Institut za nuklearne nauke, Vinca

2 Institut za biologiju i humanu genetiku, Stomatološki fakultet

3 Klinika za oralnu i maksilofacijalnu hirurgiju, Stomatološki fakultet, Beograd

 

DNK izolovana iz 17 uzoraka plemorfnih adenoma pljuvačnih žlezda (PA) i 9 uzoraka planocelularnih karcinoma (PK), analizirana je na prisustvo tačkastih mutacija u ključnim kodonima H-ras gena (12, 13 i 61.) za koje je utvrđeno da su uključene u patogenezu različitih humanih neoplazija. Primenom osetljive tehnike hibridizacije sintetičkih oligonukleotidnih proba sa in vitro amplifikovanom tumorskom DNK, tačkaste mutacije su detektovane, pretežno na kodonu 12, u 6 slučajeva PA (35 %) i 5 slučajeva P 55 % G ->C transferzije su bile dominirajuće tip baznih supstitucija u uzorcima PA, dok su u grupi PK preovladavale G ->T supstitucije, na prvoj poziciji 12. kodona. Ova visoka učestalost pacijenata sa mutacijama na H-ras genima upućuje na zaključak da alteracije ovog člana familije ras gena igraju bitnu ulogu u patogenezi nekih tipova benignih i malignih tumora glave i vrata.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ULOGA GENETIČKIH ČINILACA U ETIOPATOGENEZI KARDIOVASKULARNIH POREMEĆAJA

 

Vukosava DIKLIĆ 1, Marija KOSANOVIĆ 1, Milica TODORIĆ 2, M. VUKOTIĆ 2, S.P. STOJKOVIĆ 2

 

1 Institut za biologiju i humanu genetiku Medicinskog fakulteta Univerziteta u Beogradu, Beograd
2 Dom zdravlja Rakovica, Beograd SM

 

Naša genetički orijentisana ispitivanja su deo studije kardiovaskularnih poremećaja (KVP) u Rakovici (RASKO). Uzimajući u obzir da se osobe sa ranom pojavom KVP grupišu u porodicama na način koji jasno ukazuje na značaj genetičkih činilaca, naš zadatak je bio da identifikujemo osobe i porodice sa visokim rizikom u ilju sprovođenja preventivnih mera. Studija je radena na 176 probanada (69 muškaraca i 107 žena) koji su imali neki od faktora rizika za KVP i KVP pre 55. godine starosti (muškarci) i 65 god. starosti (žene). Kontrolna grupa se sastojala od 45 mladih, zdravih muškaraca i 28 žena. Familijarna grupisanost faktora rizika KVP i kardiovaskularnih oboljenja ispitivana je u okviru 944 srodnika probanada i 450 rodnika kontrolne grupe. Prevalencija faktora rizika: hipertenzije, dislipidemije, dijabetesa i KVP je bila signifikantno veća (p 0.001) u srodnika probanada nego u srodnika kontrolne grupe. Postoji pozitivna korelacija između kliničkog fenotipa probanada i prevalencije faktora rizika KVP i KVP u njihovih srodnika. Probanadi, muškarci i žene sa hipertenzijom kao jedinim faktorom rizika, imali su 43,3% i 46.0% rodnika sa kardiovaskularnim poremećajima. U srodnika probanada koji su imali dva li više faktora rizika KVP ili faktora rizika u kombinaciji sa KVP, ovaj procenat je viši 50.9% i 54.0%. Mortalitet uslovljen faktorima rizika KVP ili KVP je značajno veći p).005 u srodnika probanada nego u srodnika kontrolne grupe. Naša studija potvrduje opštu saglasnost da genetički činioci utiču na pojavu KVP kao i tri glavna faktora rizika za razvoj KVP.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CITOGENETSKA ANALIZA OTKRIVA "ATIPIČNE ĆELIJE" U TEČNOSTI POSLE PERITONEALNE DIJALIZE

 

Nada DIMKOVIĆ, Vitana KOSTIĆ, Dragan JOVANOVIĆ i Nada BARJAKTAROVIĆ

 

Kliničko-bolnički centar "Zvezdara", Beograd

 

Urađene su citogenetske analize na ćelijama koje su nadene u deobi u tečnosti posle peritonealne dijalize i to u 26 pacijenata koji su na hroničnom tretmanu. Kao dijagnostički kriterijumi za "atipične ćelije" poslužile su numeričke i strukturne hromozomske aberacije kariotipa. Nailazili smo na sledeće citogenetske abnormalnosti: hiperdiploidija (u 6 pacijenata, hipodiploidija (u 2) i marker hromozoma (u 2). U tri pacijenta je nađeno više od jedne hromozomske abnormalnosti. Ćelije u mitozi sa normalnim kariotipom nadene su u 11 pacijenata, dok kod preostalih osam nije ni bilo ćelija u deobi. Nije bilo posebnih razlika u odnosu na pol, starost, duzinu dijalize i incidencu peritonitisa medu pacijentima sa patološkim mitozama i onima bez njih. Da li su ovi neočekivani nalazi posledica imuno-supersivnog uremičnog statusa, same procedure dijalize ili nekih drugih faktora, ostaje za neke naredne studije i to ne samo sa citogenetskim parametrima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HISTOLOŠKA SLIKA OVARIJUMA KOD BOLESNICE SA TURNER-OVIM SINDROMOM

 

B. ĐORĐEVIĆ, D. MIHAILOVIĆ, D. STOJANOVIĆ, C. KUTLEŠIĆ, M. ČEKEREVAC, Z. POPOVIĆ i Z. STANKOVIĆ

 

Institut za patologiju, UKC, Niš

 

45,XO kariotip se karakteriše Turner-ovim sindromom. Tipična klinička obeležja 45,XO Turner-ovog sindroma su: nizak rast, primarni hipogonadizam, infantilne genitalije, pterygium colli, cubitus valgus, štitast grudni koš sa široko postavljanim bradavicama, limfedem i različite konfenitalne anomalije kao što su potkovičast bubreg i koarkcija aorte. U ovom radu, prikazana je histološka slika ovarijuma kod 16 godina stare devojke sa Turner-ovim sindromom. Histološki, ovarijum se sastoji od strome i struktura koje se normalno nalaze u hilusu: tubularne mreže i grupa ćelija koje lice na Leydig-ove ćelije. Folikuli nisu nađeni.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PRIKAZ PORODIČNE TRANSLOKACIJE 9p/10p

 

Slobodanka GRKOVIĆ i Vesna IVANOVIĆ-DERETIĆ

 

Dečja klinika Medicinskog fakulteta, Beograd

 

U radu je opisana porodica u kojoj su dva člana iste generacije imala balansiranu translokaciju 9p/10p. Ispitujući ovu familiju došli smo do podataka da je četvoro dece u toj familiji imalo teške multiple anomalije. Kod jednog deteta konstatovan je nebalansirani kariotip: 46,XY,-9 +der/9/t/9:10/p22;q24/pat. Svo četvoro dece je umrlo u ranom neonatalnom periodu. U radu smo analizirali kliničke simptome parcijalne monozomije 9P- i parcijalne trizomije 10p+. Za sledeću trudnoću savetovana je prenatalna dijagnoza. U oba slučaja rođena su zdrava deca.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKE DETERMINANTE KAO DIJAGNOSTIČKI I PROGNOSTIČKI PARAMETAR KOD NEUROBLASTOMA

 

Marija GUĆ-ŠĆEKIĆ, Dragana ANĐELKOVIĆ, V. JURUKOVSKI i Gordana PILIĆ-RADIVOJEVIĆ

 

Institut za zdravstvenu zaštitu majke i deteta RS, Beograd.

 

Neuroblastom (NB) je jedan od najmalignijih tumora u dece koji se javlja sa učestalošću od 1:5000-10000. Genetička osnova NB je veoma kompleksna i uključuje u sebe amplifikaciju N-myc onkogena kao i LOH (loss of heterozygosity - gubitak heterozigotnosti) za potencijalne supersorne gene za koje se pretpostavlja da su locirani na Ip i 14q. Amplifikacija N-myc onkogena u ćelijama NB citogenetici se detektuje kroz prisustvo homogeno obojenih regiona (HSRa) i duplih minutnih hromozoma (DMs), dok se metodom genskih proba uočava kao umnožen fluorescentni signal. LOH za supersorne gene za NB u ćelijama NB se citogenetički dokazuje kroz prisustvo delecije Ip ili 14q. U ovom radu iznosimo rezultate našeg trogodišnjeg rada tokom koga je citogenetici obrađeno 40 bolesnika sa NB, dok je kod dvoje od njih primenjena metoda fluorescentne in situ hibridizacije (FISH) u cilju detektovanja amplifikacije N-myc onkogena. Za citogenetičku obradu pacijenata korišćena je 24 h kultura ćelija koštane srži dok je za FISH korišćena N-myc proba dužine app 1kb ubačena u plazmid pBR322. U 19 slučajeva citogenetskom analizom je dobijen normalan kariotip, što je obično bilo vezano sa ranim stadijumima NB. Citogenetička analiza kod 14 pacijenata je pokazala prisustvo mozaičnog kariotipa: "neartetraploid" klon/klon sa normalnim kariotipom. LOH za Ip i lip nađen je u mozaičnoj formi sa normalnim ili "near tetraploid" klonom kod 2 pacijenta sa III i IV stadijumom tumora. Kariotip kod jednog pacijenta sa poodmaklim stadijumom tumora pokazao je LOH za Ip i 3p. HSRs su dijagnostikovani kod 4 bolesnika i korelirali su sa lošim prognostičkim tokom bolesti. FISH primenjena kod 2 bolesnika sa citogenetički dokazanim HSRs pokazala je prisustvo amplificiranog N-myc signala. Usavršavanje citogenetičkih kao i novih metoda molekularne genetike kao što je F i njihova primena kod bolesnika sa NB imaju veliki značaj kako za rano otkrivanje ovog tumora tako i za dalji prognostički tok ove bolesti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PRIKAZ SLUČAJA AUTOZOMALNE TRANSLOKACIJE CELIH KRAKOVA HROMOSOMA t/2p5p;2q5q/

 

Vesna IVANOVIĆ-DERETIĆ, Slobodanka GRKOVIĆ i B. GARŽIČlĆ

 

Dečja klinika Medicinskog fakulteta, Beograd

 

U radu je razmatrana mogućnost identifikacije, segregacije i načina prenošenja autozomalnih translokacija u kojima učestvuju celi hromospmski kraci, na primeru slučaja: 46,XY, t/2p5p;2q5q/. Posle dva spontana abortusa i jedne namerno prekinute trudnoće u kojoj je prenatalnom dijagnozom konstatovan nebalansirani kariotip, u četvrtoj trudnoći urađena je prenatalna dijagnoza i dobijen je balansirani kariotip: 46,XY, t/2p5p;2q5q/.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POPULACIONI GENETIČAR U (PRE)KLINIČKOJ PRAKSI HRONIČNIH MASOVNIH OBOLJENJA

 

Zorica JANAKOVA


Dom zdravlja, Jagodina

 

Ovo je prikaz rada tima zdravstvenih radnika (populacioni genetičar, lekar, viša sestra preventivnog smera i laboratorijski tehničar) na polju suzbijanja hroničnih masovnih nezaraznih oboljenja, odnosno na sistematskoj, temeljnoj i racionalnoj zaštiti i sprečavanju: alergijskih bolesti, pre svega bronhijalne astme u dečijem uzrastu, šećerne bolesti i srodnih i pratećih oboljenja poligene-multifiktorijalne etiologije. Ovo savetovalište se u okviru svog laboratorijskog i svog savetovališnog dela bavi populaciono-genetičkom, laboratorijskom i (pre)kliničkom obradom pojedinaca i porodice sa naslednom sklonošću i povišenim rizikom, populaciono-genetička obrada obuhvata odabir osoba (porodica) sa određenim naslednim i sredinskim činiocima. Ovaj odabir se sistematski vrši među trudnicama i porodiljama i srodnicima bolesnika, odnosno selektivno ili ciljano sistematski u ugroženim radnim, školskim i drugim kolektivima i rizičnim uzrastom, u cilju dijagnostike sklonosti. Ova prva selekcija osoba (porodica) sa rizikom značajno racionalizuje dalju ciljanu laboratorijsku i drugu obradu, bilo da se radi o povišenom stepenu atopije, imunološkim defektima, povišenoj homozigotaciji genotipa i drugim aspektima porodične sklonosti prema bolestima alergijske reaktivnosti, ili o ranim stadijumima šećerne i drugih bolesti. Zahvaljujući ovakvom pristupu ovoj masovnoj patologiji, njeni rani stadijumi postaju dostupni daljoj (pre)kliničkoj i eduktivnoj obradi i dugotrajnom praćenju u cilju sprečavanja kliničke manifestacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ZNAČAJ PRETHODNOG ODABIRA OSOBA SA POVIŠENIM RIZIKOM PREMA ŠEĆERNOJ BOLESTI U SISTEMATSKOM PREGLEDU CILJANOM NA OTKRIVANJE RANIH STADIJUMA OVOG OBOLJENJA

Zorica JANAKOVA

Dom zdravlja, Jagodina

 

U radu se sa aspekta populacione genetike i medicinske prakse utvrđuju genetički, (pre)klinički i sredinski parametri efikasnog odabira osoba sa mogućnom sniženom tolerancijom glukoze, u cilju utvrđivanja sklonosti i racionalizacije rane selekcije osoba i porodica sa rizikom. Iznosi se visok stepen efikasnosti i ekonomičnosti predloženog načina obavljanja sistematskih pregleda ciljanih na otkrivanje ranih stadijuma šećerne bolesti, koji uključuje prethodni genetički odabir osoba za ogt-test. Tako je testiranjem tek svake treće osobe adultnog uzrasta moguće postići da čak 40 % testiranih osoba ima sniženu toleranciju glukoze. Isto tako, tek je svaku sedmu porodilju ili trudnicu potrebno podvrći testu da bi kod trećine testiranih bio dokazan gestacijski dijabetes. Predlaže se osnivanje timova zdravstvenih radnika pri domovima zdravlja u cilju traganja za latentnim stadijumima šećerne bolesti i sprečavanja ili odlaganja njihove kliničke manifestacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HUMORALNI ČINIOCI VARIJATILNOSTI ALERGIJSKE REAKTIVNOSTI


Zorica JANAKOVA


Dom zdravlja, Jagodina

 

U genetičkom savetovalištu za hronična masovna nezarazna oboljenja obrađeno je 300 dece sa alergijskim oboljenjima: klinički, genetički i laboratorijski (IgE, IgA, IgM, LgG, IgD, alfa1-antitripsin, transferin, haptoglobin, ceruloplazmin, alfa2-makroglobulin, C3- i C4-komplement). Porast stepena atopije i težine kliničkog toka bolesti nije praćen kontinuiranirn promenama zastupljenosti patoloških vrednosti posmatranih imunoglobulina, plazma-proteina i komponentni komplementa, već genetičkom heterogenošću i visokim stepenom individualne varijabilnosti. Humoralni imunološki deficit i pojačana hronična nealergijska zapaljenska reakcija sudeluju u nastanku alergijske reaktivnosti umerene težine i umerenog ili normalnog stepena atopije, dok su visoka alergijska reaktivnost i njeni klinički najteži oblici etiopatogenetski relativno autonomni, tj, primarno vezani za visok stepen atopije i sopstvene genetičke izvore. Alergijska reaktivnost umereno povišenog stepena atopije češće je praćena izrazitim odstupanjima plazma-proteina i komponenti komplementa od vrednosti referentnih za uzrast. Alergijsku reaktivnost visokog stepena atopije češće odlikuju normalne vrednosti većine posmatranih plazma-proteina i komponenti komplementa ili njihova umerena odstupanja od normale. Izuzetak predstavljaju alfa-anitripsin (njegove izrazito slične vrednosti karakterišu najizrazitije oblike alergijske reaktivnosti) i haptoglobin (koji povišenim i sniženim vrednostima nešto češće prati visoku alergijsku reaktivnost). Oblik varijabilnosti numeralnih činilaca sledi ostalu genetičku i sredinsku varijabilnost alergijske reaktivnosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HROMOZOMSKE ABERACIJE I CB MIKRONUKLEUSNI TEST KAO KOMPARATIVNE METODE U BIODOZIMETRIJI JONIZUJUĆEG ZRAČENjA

 

Gordana JOKŠIĆ

 

Klinički centar Srbije Institut za medicinu rada i radiološku zaštitu "Dr Dragomir Karajović", Beograd

 

Citohalazin B mikronukleusni test kao nova biodozimetrijska metoda zasniva se na osobini hromozomskih aberacija (dicentričnih hromozoma, prstenastih hromozoma, acentričnih fragmenata, nekompletnih hromatidnih izmena, triradijala i izohromatidnih delecija) da u telofazi ćelijske deobe formiraju mirkonukleuse. Nakon akutnog ozračavanja in vitro, zapaža se gotovo idealna saglasnost rezultata učestalosti hromozomskih aberacija i CB mikronukleusnog testa. Za male doze X i gama zračenja (0.1-0.5 Gy) kalibraciona mikronukleusna kriva definisana je matematičkom relacijom y = c + aD. Najmanja doza zračenja koja se ovom metodom može odrediti za X zračenje iznosi 0.1 Gy, a za gama zračenje O.lSGy. Za doze zračenja 0.1-4 Gv X i gama kalibracione krive definisane su matematičkom relacijom y=c+aD+/3D . Najveća doza zračenja koja se pouzdano može odrediti iznosi 4 Gy. CB mikronukleusni test ima prednost u tome što se iz jednog uzorka može analizirati više hiljada limfoblasta, pa se na taj način može dobiti objektivnija slika radijacionih oštećenja kod neuniformnih ozračivanja i internih kontaminacija radionuklidima. Ipak, specifičnost dicentričnog hromozoma kao hromozomske aberacije koja predstavlja najpouzdaniji pokazatelj da je folija ozračena, ostaje nezamenljiv parametar ne samo u akcidentalnim ozračivanjima, već i u profesionalnoj patologiji.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA UČESTALOSTI GENETIČKI KONTROLISANIH KVALITATIVNIH OSOBINA U UZORKU ŽENA OBOLELIH OD KANCERA DOJKE I KOD RIZIČNE I KONTROLNE GRUPE

 

Dragana JOVANOVIĆ i D. MARINKOVIĆ

 

Biološki fakultet univerziteta u Beogradu, Beograd

 

Sprovedeno istraživanje između pacijentkinja sa familijarnim sindromom (PFS=26), pacijentkinja bez familijarnog sindroma (PBFS=44), rizične (R=70) i kontrolne grupe (K=70) je pokazalo postojanje populaciono-genetičke razlike u načinu ispoljavanja odabranih (10) homozigotno-recesivnih osobina (HRO-test), kao i u prisustvu analiziranih dermatoglifskih karakteristika. Uočena je značajna razlika između PBFS i K, kao i između PBFS i R grupe za dve HRO. Nasuprot njima PFS i R su pokazale različito ekspremiranje homo-recesivnih karakteristika u odnosu na K uzorak samo u slučaju jedne osobine. Konstatovana je značajna različitost u broju HRO osobina (0-6/6) između PBFS i kontrole i između PBFS i R grupe, dok je za poređenje PFS i K uzorka vrednost na granici značajnosti. PBFS u proseku imaju najmanji broj homo-recesivnih osobina (1.9), skoro isti kao i PFS (2.0), dok je kod R grupe u proseku zastupljeno 2.4 HRO, a u K uzorku 2.7. Dermatoglifska analiza takođe ukazuje na različitost između ispitivanih uzoraka. Zapažena je razlika u raspodeli učestalosti analiziranih (28) tipova šara za poređenje PFS sa K grupom i PBFS i uzorka. Tri tipa šara nisu zastupljena u kontroli, dok su kod pacijentkinja i rizične grupe konstatovani sa učestalošću od oko 3%. Najveću zastupljenost šest i više koturova (6-10/10) pokazuju PBFS (16%), neznatno manju R grupa (14%) i PFS (11%), a kontrolni uzorak najmanju (7%). Poređenje učestalosti krvnih grupa ABO i Rh sistema nije pokazalo značajne razlike između obolelih žena, rizične i kontrolne grupe.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EUROCAT U VOJVODINI

 

J. JOVANOVIĆ-PRIVRODSKI, A. KRSTIĆ, F. POPIĆ-PALJIĆ, R. ALEKSIĆ i G. RACA

 

Medicinski fakultet, Institut za zdravstvenu zaštitu dece i omladine, Novi Sad

 

Jedan od najsavremenijih pristupa prevenciji rađanja deteta sa kongenitalnim anomalijama je vođenje adekvatnog registra. Danas opšte prihvaćen standard za registraciju kongenitalnih anomalija je EUROCAT koji je počeo da se koristi 1979. godine u zemljama Zapadne Evrope. Tokom 1992. godine metodom EUROCAT je obavljeno registrovanje kongenitalnih anomalija i genetskih bolesti u Vojvodini. Na 15025 živorođenih registrovano je 404 malformisane ili obolele novorođenčadi što daje incidencu 2,68%. Svakim EUROCAT-om pa i ovim našim dobijeni su:

1) tačni epidemiološki podaci, kao i geografska rasprostranjenost osoba sa kongenitalnim anomalijama,

2) kontrola zagađenosti sredine koja dovodi do maldeformacija (nivo teratogenoze i mutacija (nivo mutageneze)

3) pravovremeno otkrivanje dece rođene sa kongenitalnim anomalijama u cilju preduzimanja odgovarajućih tretmana

4) mogućnost planiranja bolje prevencije rađanja dece sa fizičkim i psihičkim hendikepom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HLASISTEM-GENETSKI MARKER ZA PRENATALNU DIJAGNOSTIKU JUVENILNOG DIJABETES MELITUSA (Prikaz slučaja)

 

J. JOVANOVIĆ-PRIVRODSKI, A. KRSTIĆ, F. POPIĆ-PALJIĆ, Z. PILIĆ

 

Medicinski fakultet, Institut za zdravstvenu zaštitu dece i omladine, Novi Sad

 

Prenatalna tipizacija HLA sistema kao i signifikantna asocijacija HLA DR 3, DR 4 i DR 3,4 lokusa sa inzulin zavisnom šećernom bolesti koriste se za davanje genetičke informacije porodicama kod kojih postoji juvenilni dijabetes melitus. Prikazujemo slučaj pacijentkinja koja ima dete sa juvenilnim dijabetesom (HLA tipizacija na DR lokus 3,4) a koja se javila u Medikogenetsko savetovalište u Novom Sadu, želeći da sazna za rizik za naredno potomstvo. Pacijentkinji je savetovana prenatalna tipizacija HLA sistema postupkom kordocenteze (intervencija kojom se u 20. nedelji trudnoće preko prednjeg trbušnog zida pod kontrolom UZ-a uzme fetalna krv). HLA tipizacija fetalne krvi je utvrdila lokus DR 4,6. Izračunati rizik za HLA DR 4,6 lokus je 29%, a u slučaju da je DR lokus 3,4 iznosi 68%. Znači rizik za ovaj plod je upola manji nego da je konstelacija HLA sistema DR 3,4. Pacijentkinji je saopšten rizik i ona je odlučila da rodi dete.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA ISTRAŽIVANjA KARDIOVASKULARNIH OBOLJENJA

 

Vesna KNEŽEVIĆ 1, Vukosava DIKLIĆ 2, Marija KOSANOVIĆ 2 i N. VOJVODIĆ 3

 

1 Medicinski centar, Mladenovac

2 Institut za biologiju i humanu genetiku, Medicinskog fakulteta, Beograd

3 Gradski zavod za gerontologiju, Beograd

 

Porodična grupisanost kardiovaskularnih oboljenja (KVO) i faktora rizika KVO je dobro poznat fenomen. Naša studija porodica je obuhvatila 132 mlade žene koje su imale hipertenziju, a neke od njih i druge faktore rizika KVO. Kontrolna grupa se sastojala od 74 mlade žene bez hipertenzije. Analiza porodične grupisanosti faktora rizika KVO i KVO je obuhvatila 642 srodnika I stepena i 1039 srodnika II stepena probanada i 378 srodnika I stepena i 654 srodnika II stepena kontrolne grupe. Prevalencija hipertenzije u srodnika probanada i I i II stepena je bila signifikantno veća nego u srodnika kontrolne grupe (p< 0.001, rr 1.7; p< 0.002, rr 1.6). Prevalencija kardiovaskularnih oboljenja je bila signifikantno veća samo u majki pacijenata (p< 0.02). Poređenje lipidnog statusa ispitivanje i kontrolne grupe su pokazale, da su u hipertenzivnoj grupi bile signifikantno veće prosečne vrednosti triglicerida, i signifikatno niži nivoi HDL - holesterola, dok su nivoi ukupnog holesterola u LDL holesterola u serumu bili viši, ali bez statističke značajnosti. Deo rezultata ovih ispitivanja, koji se odnose na asocijaciju nivoa lipida u serumu i DNK polimorfizama gena za apo B, objavljen je u časopisu Genetika, Vol. 25,1,1-19,1993.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POREKLO X HROMOZOMA U PACIJENTA SA ROBERTSONOVOM TRANSLOKACIJOM I TARNEROVIM SINDROMOM

 

M. KRAJINOVIĆ 1,2, K. IVANOVIĆ 3, L. MESTRONI 2, V. DIKLIĆ l i J. NIKOLIŠ l

 

1 Institut za biologiju i humanu genetiku, Medicinski fakultet, Univerzitet u Beogradu, Beograd

2 Internacional Centre for Genetic Engineering and Biotechnology, UNIDO, Trieste, Italy
3 Pedijatrijsko odeljenje Opšte bolnice, Pančevo,

 

U radu je prikazan probant sa Robertsonovom translokacijom nasleđenom od oca i Turnerovim sindromom. Studija porekla X hromozoma urađena je analizom dinukleotidnih polimorfizama (mikrosateliti) uz korišćenje lančane reakcije polimerizacije. Analize su pokazale da je probant nasledio X hromozom od oca (Xpat). Diskutuje se nastajanje hromozomskih aberacija kao posledica interhromozomskih interakcija.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

REGISTRACIJA HROMOZOMSKIH ABERACIJA METODOM D.S. BORGOANKARA-REPOS


A. KRSTIĆ, M. KOVAČEVIĆ, G. RACA, F. POPIĆ-PALJIĆ, J. JOVANOVIĆ-PRIVRODSKI, R. ALEKSIĆ, N. ČAMBER, R. MADŽAR, V. Č
IHI, Lj. GAĆINA, N. MITROVČAN i Lj. MALEŠEVIĆ

 

Podaci o hromozomskim aberacijama dijagnostikovanim u citogenetskim laboratorijama širom sveta, više od 25 godina sakupljaju se i registruju u kompjuterskom centru na univerzitetu u Delaveru. Tvorac ideje o registraciji i metodologije no kojoj se ona vrši je D.S. Borgoankar, direktor citogenetske laboratorije Medicinskog centra u Delaveru. Kao rezultat želje da se iskoriste prednosti ovog proverenog sistema registracije, u Citogenetskoj laboratoriji Dečije bolnice u Novom Sadu razvijen je praktičan softver za PC i PC kompatibilne računare, koji regustruje, sortira i štampa podatke o hromozomskim aberacijama po metodologiji Digamber S. Borgoankara. Funkcioniše od 1993. godine i u njegovoj bazi podataka već su pohranjeni podaci o većini hromozomskih aberacija koje su dijagnostikovane u laboratoriji u Novom Sadu u toku njenog dugogodišnjeg rada (od 1969. do marta 1994. ukupno 554 slučaja). Rad na registraciji sada se odvija kontinuirano. Podaci za 1993. godinu priređeni su za slanje i poslati u svetski registar u Delaveru. Uvođenjem REPOSA (skraćenica od englesku reč REPOSITORY) postignut je dobar uvid u dosadašnje rezultate rada laboratorije i obezbeđeno sistematsko praćenje u budućnosti. Poboljšanje je komunikacija sa svetskim registrom što treba da omogući potpunije korišćenje svih njegovih prednosti, a omogućava registrovanje svih hromozomskih anomalija otkrivenih u svim laboratorijama u SRJ, kao i mogućnost korišćenja podataka o tome šta je u svakom trenutku otkriveno kod nas u Medicinskoj citogenetici.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MORALNO-ETIČKI ASPEKT PRENATALNE DIJAGNOZE NASLEDNIH OBOLJENJA

 

M. KRSTIĆ, Stefanija MARKOVIĆ i Slavenka ADŽIĆ

 

Institut za ginekologiju i akušerstvo KCS, Beograd

 

Prenatalna dijagnostika naslednih oboljenja uključuje intervencije koje su neminovno prožete etičko-pravnim problemima. Kada se prenatalnom dijagnozom otkriju poremećaji ploda potrebno je doneti odluku o njegovoj daljoj sudbini. Odluka se donosi na osnovu genetičkih analiza i saznanja da je u pitanju poremećaj koji će se ranije ili kasnije ispoljiti u životu. Prema etičkoj proceni primena prenatalne dijagnoze i odluka o eventualnom prekidu trudnoće spadaju u domen medicinsko-genetičkog savetovanja. Odluka se donosi na osnovu mišljenja lekara i genetičara, a prvenstveno roditelja kojima se ukazuje na stepen poremećaja njihovog budućeg deteta. Ne retko lekari i genetičari su suočeni sa dilemom kako da zauzmu određen stav, a pogotovu da daju savet roditeljima o prekidu trudnoće. Na Institutu za ginekologiju i akušerstvo KCS u savetovalištu za genetiku javljaju se problemi u vezi sa postupkom u slučaju kada se otkriju fetusi sa hromozomskom konstitucijom: XYY, XXX i drugim varijantama uključivši i razne tipove mozaicizma. Autori žele da ukazu na teškoće u donošenju odluke u gore pomenutim slučajevima imajući u vidu moralnu dilemu nekih etičara i genetičara a po pitanju ko je uopšte pozvan da proceni da li je neki život vredan življenja ili nije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CITOGENETIČKA ISPITIVANJA U MEDICINSKOJ GENETICI

Živana LACA

 

Centar za Medicinsku genetiku
Institut za mentalno zdravlje, Beograd

 

U našem Centru za Medicinsku Genetiku citogenetičke analize nalaze široku primenu u različitim ispitivanjima. 1. Ispitivanje otiologije pojedinih oboljenja i sindroma - Razvoj i primena metoda diferencijalnog bojenja hromozoma omogućili su otkrivanje velikog broja numeričkih i strukturnih hromozomskih aberacija u nizu oboljenja i sindroma. U ispitivanjima ove vrste nailazi se na subtilne strukturne promene čije razjašnjenje zahteva angažovanje stručnjaka različitog profila (citogenetičar, molekularni biolog, endokrinolog itd.), 2. Prevencija rađanja dece sa hromozomskim aberacijama - Prenatalna analiza kariotipa ploda sprovodi se u svim slučajevima gde za to postoji indikacija. Pojedini nalazi i njihovo tumačenje čine davanje saveta veoma delikatnim zadatkom. 3. Prevencija maligniteta - U grupi pacijentkinja sa disfunkcijama i disgenezijama gonada, citogenetička analiza omogućava otkrivanje prisustva Y hromozoma u jednom broju pacijentkinja sa gonadalnim disgenezijama ili lestikularnom feminizacijom. To omogućava blagovremeni hirurški zahvat i otklanjanje nediferenciranih gonada sklonih malignizaciji. 4. Objašnjenje nastanka određenih poremećaja na hromozomskom nivou - Analiza hromozomskih polimorfizama, a naročito primene NOR tehnike bojenja omogućava praćenje porekla hromozomskog nerazdvajanja. 5. Praćenje određenih procesa na nivou ćelije kao što su: mitotska deoba aberantnih hromozoma, ćelijska kinetika u pojedinim sindromima itd. 6. Testiranje hipoteza o nastanku hromozomskih aberacija.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UPOTREBA FLUORESCENTNE IN SITU HIBRIDIZACIJE ZA IDENTIFIKACIJU MARKER HROMOZOMA KOD PACIJENATA SA TARNEROVIM SINDROMOM

 

Milena LUDOSKI 1, Ljiljana LALIĆ 2, Vera POPOVIĆ 2, V. JURUKOVSKI 4 i Angelina NOVAK 1

 

1 Laboratorija za Humanu Genetiku Instituta za Hematologiju i Instituta za Endokrinologiju, Univerzitetsko - kliničkog centra, Beograd,

3 Laboratorija za Citogenetiku, Vojno - medicinske Akademije, Beograd

4 Inslitut za Molekularnu Genetiku i Genetičko inženjerstvo, Beograd

 

Tokom indentifikacije marker hromozoma kod pacijenata sa kongenitalnim poremećajima citogenetičari su se suočavali sa puno teškoća, uprkos razvoju mnogobrojnih specijalizovanih tehnika bojenja. Međutim, nov metod, fluorescentne in situ hibridizacije (FISH) sa hromozomom-specifičnim DNA probama je ponudio rešenje ovog problema. Mi opisujemo dve pacijentkinje sa fenotipskim karakteristikama Tarnerovog sindroma, a citogenetska analiza, urađena tehnikom HG-traka, je u obe pacijentkinje otkrila mozaičan kariotip, 45,XO/46,X,r(?). Oba otkrivena marker hromozoma su ring hromozomi. Jedine razlike su u procentu delija sa abnormalnim, 46,X,r, kariotipom i u veličini ring hromozoma. Fluorescentna in situ hibridizacija je urađena posle citogenetske analize na istim pločicama sa biotiniliranom probom, pBamX5, koja predstavlja visoko repetitivne DNA sekvence specifične za centromeru X hromozomima. Ovom tehnikom je pokazano da ring hromozomi, u obe pacijentkinje, potiču od X hromozoma. Citogenetska studija tehnikom Q-traka isključuje prisustvo fluorescentnog dela dugog kraka Y hromozoma u oba markera. Možemo zaključiti da kombinacija citogenetskih metoda i FISH tehnike značajno povećava mogućnost identifikacije marker hromozoma a time i otkrivanja prave dijagnoze bolesti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RING (15) - PRIKAZ SLUČAJA

 

B. LUKIĆ, Nada BARJAKTAROVIĆ, Nada TODOROVIĆ i Vitana KOSTIĆ

Kliničko-bolnički centar "Zvezdara", Beograd

 

Autori prikazuju slučaj ženskog novorođenčeta, rođenog dve nedelje pre termina, telesna težina na rođenju 2300 gr, dužine 43 cm, obima glave 30 cm. Novorođenče malo za termin, nema znakova pothranjenosti, vidljive stigmate vezane samo za ekstremitete koji su kraći, posebno nadlaktice, a na stopalima izražen obostrani metatarsus varus. Postoji mala umilikalna hernija. Sve analize su se nalazile u fiziološkim granicama. Ponašanje neupadljivo, neurološki nalaz uredan. Tok hospitalizacije uobičajen. Citogenetska analiza je pokazala da se radi o kariotipu 46,XX,r (15) (p12,qZ6). U literaturi postoji mali broj opisanih slučajeva ovog sindroma i uglavnom se klinička slika poklapa sa gore opisanom. Izuzev značajnog deformiteta oba stopala, nekih velikih fenotipskih promena nema. Za formiranje ring-hromozoma potrebna je dvostruka delecija, i na "p" i na "q" kraku hromozoma 15, što znači da se ipak radi o deficitu jedne određene količine genetskog materijala.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HROMOZOMSKE ABERACIJE U TRI OVARIJALNA KARCINOMA

 

Ljiljana LUKOVIĆ 1, Jelena MILAŠIN 2, N. ARSENOVIĆ 3 i Vukosava DIKLIĆ 1

 

1 Institut za Biologiju i Humanu genetiku, Medicinskog i

2 Stomatološkog fakulteta, Beograd,

Ginekološko-akušerska klinika, KBC, Beograd

 

Citogenetički su ispitivana 3 uzorka ovarijalnih karcinoma, dva histopatološki utvrđena serozna adenokarcinoma i jedan cystadenokarcionom. U vreme ispitivanja pacijentkinje nisu bile pod radio ili hemoterapijom. Hromozomi su dobijeni direktnom tehnikom preparacije solidnih tumora, a bojeni GTG tehnikom. Kako u pogledu broja tako i u pogledu strukture hromozoma utvrđena je izrazita raznolikost u okviru i među uzorcima. Broj hromozoma se kretao u rasponu od 27-90 (u jednoj mitozi 400 hromozoma). Veliki marker hromozomi su prisutni u sva tri slučaja. Poreklo marker hromozoma, delimično ili u potpunosti, nije bilo moguće uvek da se utvrdi usled, pretpostavljamo, složenih preraspodela manjih delova hromozoma. Hromozomi 1,3,6,7 i 11 su najčešće zahvaćeni strukturnim aberacijama, što je u skladu sa nalazima drugih istraživača. U jednom slučaju su prisutni DM (minutni hromozomi), dok su u drugom nađeni HSR (homogeno obojeni regioni). U literaturi opisana aberacija 6q-, koja se smatra specifičnom za ovarijalne karcinome, nađena je u 2 slučaja. I pored izuzetne kariotipske složenosti, uočeno je da su izvesni hromozomski regioni češće zahvaćeni prekidima ili delecijama, što upućuje na to da su upravo tu smešteni geni koji igraju ulogu u stvaranju i progresiji nekih tumora ovarijuma.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA HOMOZIGOTNOST I NORMALNA I PATOLOŠKA HUMANA VARIJABILNOST

 

D. MARINKOVIĆ, D. JOVANOVIĆ, S. CVJETIČANIN i S. BRANKOVIĆ

 

Biološki fakultet Univerziteta u Beogradu, Beograd.

 

Stepen genetičke homozigotnosti meren je utvrđivanjem prisustva izrazitih homozigotno-recesivnih kvalitativnih karakteristika (HRC-TEST). Analize su vršene u nizu uzoraka stanovništva R. Srbije, pri čemu su, u okviru pojedinih populacija, najčešće upoređivani uzorci ispitanika koji boluju od nekog suspektno naslednog oboljenja, u odnosu na uzorke zdravih osoba. Konstatovano je uvećano prisustvo HR karakteristika kod uzoraka osoba obolelih npr. od endemske nefropatije, šećerne bolesti, distrofije mišica, luksacije kuka, hronične limfatične leukemije, pa i Ca materice, dok je prosečna vrednost bila ista ili manja (ali uz različitu distribuciju HRC) kod uzoraka obolelih od apendicitisa, bronhijalne astme, bronhogenog karcinoma i Ca dojke. Korišćena metodologija se i dalje koristi i usavršava, radi eventualne primene u genetičkom savetu.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ ABERACIJA POLNIH HROMOZOMA NA SPERMATOGENEZU

 

Miroslava MIĆIĆ

 

Institut za biologiju i hum. genetiku, Stomatološki fakultet, Beograd

 

Među muškarcima koji su ispitivani i lečeni zbog infertiliteta, nađena su i aberacije polnih hromozoma. Od strukturnih aberacija polnih hromozoma najčešće su delecije Yq različitog stepena koje su uglavnom imale negativan uticaj na fertilitet. Ostale strukturne aberacije su izuzetno retke i do sada smo uočili sledeće: 47,XisoXqY; 45,X, 46,XisoYq; 45,X, 46,XringY; 46,X t(Y;13). Svi pacijenti su imali azospermiju. Biopsija testisa je pokazala odvijanje procesa spermatogeneze kod svih slučajeva izuzev pacijenta sa 47,Xis Xq kariotipom. Pacijenti sa aberacijama Y hromozoma i pored mozaicizma imali su sve faze spermatogeneze uz značajno smanjenje broja ćelija u kasnijim stadijumima. Linija sa 45,X hromozomskom konstitucijom nije bila prisutna u ćelijama testisa. Analiza ćelija u diakinezisu-metafazi I pokazala je poremećaje u sparivanju bivalenata što je uticalo na odvijanje procesa i brojnost ćelija u kasnijim stadijumima. Razmatran je uticaj anomalije V hromozoma na proces spermatogeneze i fertilitet pacijenta.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ZAPREMINA JEDARA U PATAUOVOM SINDROMU

 

D. MIHAILOVIĆ, Z. STANKOVIĆ, B. ĐORĐEVIĆ, V. MIHAILOVIĆ i M. ČEKEREVAC

Institut za patologiju Medicinskog fakulteta, Niš

 

Kariometrijski parametri koriste se u histopatologiji zbog dobro poznate korelacije između zapremine ćelijskog jedra i količine DNK. U ovom radu određivana je prosečna zapremina jedara različitih ćelija kod bolesnika sa Patauovim sindromom (trizomija 13). Na nepristrasan način, kod 3 novorođenčeta određivana je, posle standardne formalinske fiksacije, kalupljenja u parafin, sečenja i hematoksilin-eozin bojenja, prosečna volumen-zavisna zapremina jedara (Vv) po formuli VV=I03∙π/3, gde I0 predstavlja dužinu jedarnog intercepta koji je meren u slučajnom pravcu na jedru koje je pogođeno tačkom testnog sistema. Kod bolesnika sa Pataouovim sindromom nađena je statistički značajno manja zapremina hepatocita i endokrinih ćelija pankreasa, u poređenju sa kontrolom. Ovi rezultati ukazuju da količina DNK i prosečna zapremina jedara mogu predstavljati različite biološke informacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UČESTALOST AKROCENTRIČNIH ASOCIJACIJA KOD ŽENA SA SPONTANIM ABORTUSOM

 

V. MIHAILOVIĆ, Z. STANKOVIĆ, D. MIHAILOVIĆ i D. STOJANOVIĆ

 

Institut za patologiju Medicinskog fakulteta, Niš

 

U kariotipu čoveka 5 parova akrocentričnih hromozoma nose regione nukleolarnih organizatora i pokazuju tendenciju ka intragrupnoj asocijaciji i gomilanju. Opisano je smanjenje učestalosti asocijacije akrocentričmh hromozoma kod osoba starijeg životnog doba, u poređenju sa osobama srednjih godina. Cilj ovog rada je analiza učestalosti asocijacija akrocentričnih hromozoma kod žena sa spontanim abortusima. Analizirane su metafaze kulture limfocita. Učestalost satelitskih asocijacija je veća kod žena sa spontanim abortusima, u poređenju sa kontrolnom grupom, što ukazuje na moguće nerazdvajanje hromozoma u mitozi.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MUTACIJE H-ras GEN A U TUMORIMA URINARNOG TRAKTA ČOVEKA

 

Jelena MILAŠIN 1, Nasta DEDOVIĆ 2, S. MIĆIĆ 3, B. DIMITRIJEVIĆ 2, Vukica DIKLIĆ l

 

1 Institut za biologiju i humanu genetiku, Stomatološki fakultet, Beograd
2 Institut za nuklearne nauke, Vinča, Beograd

3 Urološka klinika Medicinski fakultet, Beograd

 

Alteracije ras gena, a samim tim i njihovih produkata p21 proteina su dovedene u vezu sa patogenezom različitih malignih oboljenja kod čoveka. Članovi familije ras gena (H, K i N) stiču onkogeni, transformišući potencijal tačkastim mutacijama u kodonima 12,13 i 61. DNK dobijena iz 32 uzorka karcinoma prelaznog epitela mokraćne bešike, uretera i bubrežne karlice kao i 22 uzorka karcinoma bubrega analizirana je na prisustvo aktivirajućih mutacija u H-ras genima. Koristeći tehniku in vitro amplikacije tumorske DNK i hibridizacije sa oligonukleotidnim probama, mutacije su detektovane u 7 od 32 uzorka karcinoma prelaznog epitela (22 %) i 3 od 22 uzorka karcinoma bubrega (13,6%). U prvoj grupi tumora dominirale su supstitucije tipa tranzicije G=>A na 12. kodonu (GGC=>ACG i GGC=>GAC, odnosno zamena glicina u prvom slučaju serinom, a u drugom slučaju asparaginskom kiselinom). U tumorima bubrega bila je zastupljena ista tranzicija ali na 13. kodonu (GGT=>GAT). Ukupna učestalost mutacija od 18 % ukazuje na to da aktivacija ras gena nije ključni događaj u nastanku tumora urinarnog trakta.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

REAKCIJA HUMANIH T LIMFOCITA U DIFERENCIRANOM I NEDIFERENCIRANOM STANJU NA DEJSTVO MAFOSFAMIDA I 5-FLUOROURACILA IN VITRO

 

Olivera MILOŠEVIĆ-ĐORĐEVIĆ l i Nada BARJAKTAROVIĆ 2

 

1 Prirodno matematički fakultet, Univerzitet u Kragujevcu, Kragujevac ,

2 Klinička bolnica grada Beograda, Beograd

 

Ispitivan je efekat alkilirajućeg agensa mafosfamida i analoga nukleinskih kiselina 5-fluorouracila, koji su najčešće korišćeni lekovi u hemioterapiji kancera. Poznato je da ciklofosfamid ne deluje kao alkilant, već in vivo podvrgava metaboličkoj aktivaciji. Derivat 4-hydroxycyclophosphamida je mafosfamid, aktivno jedinjenje i u in vitro i u in vivo uslovima. Primenjen je test frekvence hromozomskih aberacija u kulturi humanih limfocita, koji su u vreme tretmana agensima PHA stimulisani ili ne. Medikamenti su testirani u koncentracijama 9 ug/ml za mafosfamid i 11,4 x 10-3 M za 5-fluorouracil. Uporedo je vršena i analiza frekvence hromozomskih aberacija u kontrolnim netretiranim kulturama limfocita istih ispitanika. Mafosfamid i 5-fluorouracil su indukovali značajno povećanje frekvence hromozomskih aberacija u limfocitima koji su u vreme tretmana i PHA stimulisani (5,7*** i 6,9***). Za razliku od 5-fluorouracila, mafosfamid je indukovao povećanje frekvence hromozomskih aberacija i u ćelijama koje u vreme tretmana nisu PHA stimulisane (9,9*** i 1,2). Najfrekventnije su aberacije tipa hromozomskih (49 %) i hromatidnih prekida (36 %), ahromatskih lezija (30,5 %) i dicentričnih hromozoma (2 %). 5-fluorouracil je indukovao isključivo aberacije tipa prekida.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CITOGENETSKO ISPITIVANJE HROMOZOMA BOLESNIKA SA INCONTINENTIO PIGMENTI

 

S. MINIĆ 1. M. KOSANOVIĆ 2 i B. PETROVIĆ 2

 

1 Klinika za kožne bolesti, UKC, Beograd ,

2 Institut za biologiju i humanu genetiku, Medicinski fakultet, Beograd

 

Incontinentio pigmenti (IP) poznata i kao Bloch-Sulzberger sindrom, Bloch-Siemens sindrom retka, kompleksna genodermatoza u kojoj su kožne promene često udružene sa anomalijama drugih organa i struktura, pretežno ektodermalnog porekla. Javlja se gotovo isključivo u ženske dece. Pozitivna porodična anamneza u visokom procentu slučajeva (do 55,4%) i češće obolevanje ženske nego muške dece (odnos 17:1) ukazale su da bi neke promene u genomu mogle da budu osnova nastanka ove bolesti. Imajući u vidu da mnogi problemi vezani za IP nisu rešeni pokušali smo u našim istraživanjima da na osnovu geneoloških stabala porodica probanata utvrdimo naslednost, odnosno tip nasleđivanja i izvršimo analizu kariotina bolesnika i njihovih srodnika i utvrdimo da li je u njih IP posledica aberacije hromozoma ili genske mutacije. Naši rezultati su pokazali da je apsolutna većina (10 do 11 ispitanika) imala familijarnu pojavu IP. Familijarni oblici IP potvrđuju naslednost ove bolesti, a geneološka stabla govore u prilog mišljenja da se IP nasleđuje kao X-vezano dominantno oboljenje. IP se prenosi sa majke na ćerku. U porodicama probanata nema obolelih muških članova. Citogenetskom analizom svih obolelih od IP, iako su imali familijarni karakter, nađen je normalan kariotip.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

Ag - NOR - ovi U NORMALNOJ HUMANOJ POPULACIJI

 

J.NIKOLIŠ 1, V. KEKIĆ 2, S. MIĆIĆ 3, V. DIKLIĆ 1, M. RISTANOVIĆ l

 

1 Institut za biologiju i humanu genetiku Medicinskog fakulteta Univerziteta u Beogradu, Beograd

2 Biološki fakultet, Univerzitet u Beogradu, Beograd
3 Urološka Klinika UKC u Beogradu, Beograd

 

Ispitivana je aktivnost regiona - organizatora nukleolusa (NOR) u limfocitima 49 muškaraca u starosnom dobu od 11-74 godina i 48 žena starih 18-74 godine. Cilj rada je bio da se ispita da li postoje razlike u učestalosti Ag - obojenih NOR-ova između različitih starosnih grupa, kao i između polova. Dobijeni rezultati ukazuju na značajnu razliku u učestalosti aktivnih NOR-ova između muškaraca i žena, dok korelacija između broja Ag NOR-ova i starosti jedinke nije utvrđena.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

INTERFAZNA CITOGENETIKA: OTKRIVANJE GENOMSKE KONSTITUCIJE JAJNIKA (HISTOLOŠKI PREPARATI) U BOLESNIKA SA TURNER SINDROMOM I HROMOZOMSKIM MOZAICIZMOM

 

Angelina NOVAK 1, Đ. KOKAI 2, Vera POPOVIĆ 3, Milena LUDOŠKI l, V.

JARUKOVSKI 4

 

1 Laboratorija za Humanu Genetiku, Institut za Hematologiju, Beograd

2 Odeljenje Patologije Ginekološko-Akušerske klinike, Beograd

3 Institut za Endokrinologiju, Univerzitetsko-Kliničkog Centra, Beograd i

4 Institut za Molekularnu genetiku i Genetičko inženjerstvo, Beograd

 

Teškoće u otkrivanju mozaicizma polnih hromozoma, sa do sada poznatim klasičnim tehnikama citogenetike, predstavljaju jedan od glavnih problema u objašnjavanju diskrepance fenotip-genotip u ovih bolesnika. Tehnika floroscentne in situ hibridizacije (FISH), sa korišćenjem DNK probe specifične za X hromozoma, dozvoljava identifikaciju genoma bolesnika sa mozaičnim kariotipom i u interfaznim jedrima ("interfazna citogenetika"). Mi smo, u ovome radu, pokazali efikasnost "interfazne citogenetike" u otkrivanju genomske konstitucije ovarijuma bolesnice sa Turner-ovim sindromom i mozaičnim kariotipom (46,XX / 45,XO) prethodno otkrivenim u kulturi limfocita periferne krvi. Koristili smo DNK alfoidne repetitivne sekvence specifične za X-humani hromozom obležene biotinom, probu PBamXS. Analiza interfaznih jedara bukalne sluzokože FISH tehnikom je pokazala normalan kariotip 46,XX u svim ćelijama. Analize interfaznih jedara: limfocita periferne krvi i ćelija strome jajnika (histološki preparati) su pokazali prisustvo obe ćelijske linije sa kariotipom 46,XX / 45,XO. Analiza germinitivnih ćelija /oocita u primordijalnim folikulima jajnika je pokazala normalan kariotip 46,XX. Naši rezultati: 1. pokazuju primenljivost interfaznc citogenetike na histološkim preparatima, 2. daju mogućnost određivanja genomske konstitucije tkiva koje se ne može analizirati rutinskim citogenetskim tehnikama i 3. nude potpuno nov metodološki pristup u određivanju procenta prisutnosti abnormalnog klona u mozaicima različitih organa i tkiva koja se ne dele.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MONOSOMIJA HROMOSOMA 22 - PRIKAZ SLUČAJA

 

Ivana NOVAKOVIĆ 1, Olga ANTONOVIĆ 2, Slavenka ADŽIĆ 2 i Svjetlana MAGLAJIĆ 3

 

1 Institut za biologiju i humanu genetiku, Medicinski fakultet

2 Institut za ginekologiju i akušerstvo, KCS, Beograd

Univerzitetska dečja klinika, Beograd

 

Prikazujemo novi slučaj monosomije hromosoma 22. Proband je bilo žensko novorođenče sa facijalnom dismorfijom, bilateralnim leukomom cornee, srčanom grbom, izduženim, disproporcionalnim prstima stopala i mišićnom hipotrofijom. Analizom kariotipa utvrđena je hromosomska konstitucija 45,XX, - 22.inv(9). Novorođenče je umrlo ubrzo nakon rođenja. Autopsijom je utvrđen truncus arteriosus persistens - tip III. atrijalni septalni defekt i perzistentna leva vena cava superior. Naš slučaj poredimo sa do sada objavljenim slučajevima monosomije 22 u čistoj Hi mozaičnoj formi.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKI PRIKAZ PORODICE SA UČESTALOM POLYDACTILYOM

 

V. NOVOSEL

 

Medicinski institut Univerziteta Crne Gore, Podgorica

 

Opisan je slučaj porodice sa izraženom učestalošću polydactilye na obje ruke i noge. Anamnestički podaci ukazuju da pojava polydactilye ima korijena u II-oj generaciji, a do potpunog izražaja dolazi u IV-oj generaciji kod tri sestre koje su bile objekat ispitivanja. Anomalija koja se ispoljava u vidu šestog prsta, iz rendgenskog snimka se jasno vidi razvijena metakarpalna kost sa distalne strane ruku i nogu. Analiza metafaznih hromozoma i polnog hromatina ukazuje da se radi o normalnom kariotipu sa 46,XX. Iz utvrđenih podataka može se zaključiti da je anomalija nastala kao posledica mutacije gena čija izražajnost dolazi u IV-oj generaciji.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

FAMILIJARNA 46,XY GONADALNA DIZGENEZA

Vesna PENDIĆ 1, Vera POPOVIĆ 2 i Angelina NOVAK 1

1 Laboratorija za Humanu Genetiku, Institut za Hematologiju, Beograd
2 Institut za Endokrinologiju, Univerzitetsko-Kliničkog Centra, Beograd

 

Swyer sindrom se karakteriše: ženskim fenotipom (bilateralne tube, uterus i vagina), primarnom amenoreom i kariotipom 46,XY. Predispozicija ka neoplazijama gonada: gonadoblastoma i germinoma, je velika. U ovome radu prikazujemo bolesnicu sa normalnim ženskim fenotipom, primarnom amenoreom, a kariotipom 46,XY. Bolesnici je, takođe, hirurškim putem uklonjen jedan jajnik sa dijagnozom dysgerminoma ovarii. Citološko ispitivanje tehnikom Q-traka potvrdilo je prisustvo jasno fluoroscirajućeg "Y-tela" u epitelijalnim ćelijama bukalne sluzokoze. Citogenetsko ispitivanje, tehnikom HG-traka, metafaza limfocita periferne krvi, je pokazalo prisustvo kariotipa 46,XY bez bilo kakvog strukturnog rearanžmana Y hromozoma. Objašnjenje nekomplementarnosti ženskog fenotipa i muškog genotipa sa prisutnim citogenetski normalnim Y hromozomom je i postojanje identičnog genotipa (46,XY) i normalnog ženskog fenotipa i u sestre naše bolesnice. Ovi rezultati ukazuju da je 46,XY gonadalna disgeneza familijarna bolest koja se nasleđuje recesivno, X-vezano.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UČESTALOST KRVNIH GRUPA ABO SISTEMA U NEKIM PLUĆNIM BOLESTIMA

 

D. PEŠUT 1, D. MARINKOVIĆ 2

1 Institut za plućne bolesti i tuberkulozu, Klinički centar Srbije, Beograd
2 Biološki fakultet P.M.F. Univerzitet u Beogradu, Beograd

 

Ispitana je učestalost krvnih grupa ABO sistema među obolelima od tuberkuloze pluća (TBC), plućne hidatidoze i bronhogenog cinoma. U svim slučajevima oboljenja dijagnoza je postavljena u Institutu za plućne bolesti i tuberkulozu Srbije. Značajnost nađenih odstupanja učestalih krvnih grupa ABQ sistema u odnosu na očekivane vrednosti u jugoslovenskoj populaciji testirana je X testom. U grupi operisanih od hidatidne ciste pluća (N=84) nađena je statistički značajno manja učestalost krvne grupe A u odnosu na jugoslovensku populaciju. Nađena je veća učestalost krvne grupe B i AB ali bez statističke značajnosti. U grupi bolesnika sa TBC pluća (N=79), koju su činili oboleli od fibrokazeozne kavernozne (FC) forme bolesti i specifičnog pleuritisa, nađena je statistički značajno manja učestalost krvne grupe O u odnosu na opštu populaciju. Signifikantno veća učestalost krvne grupe B nađena je među obolelima od FC i TBC pluća dok je krvna grupa O učestalija kod obolelih od pleuritisa. U grupi obolelih od bronhogenog karcinoma (N=105) nije nađeno značajno odstupanje učestalosti tipova ABO u odnosu na jugoslovensku populaciju, odnosno, odstupanje opada sa povećanjem broja ispitanika u ovoj grupi. Rczultati govore u prilog genetskoj predispoziciji/otpornosti ka plućnoj TBC uopšte a i prema formi bolesti. Predstavljaju doprinos kontroverznim rezultatima ispitivanja učestalosti ABO sistema krvnih grupa u TBC koje nalazimo u literaturi poslednje dve decenije a koji nisu uzimali u obzir formu oboljenja. Ukazuju na genetički uticaj čak i u parazitskoj bolesti pluca. Izgleda da su osobe sa krvnom grupom A otpornije na plućnu hidatidozu dok su one sa krvnim grupama A i zahvaćene bolešću.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKO SAVETOVANJE BRAČNIH PAROVA U SLUČAJU DELOVANJA ŠTETNIH NOKSI IZ SPOLJNE SREDINE

 

F. POPIĆ-PALJIĆ, A. KRSTIĆ, J. JOVANOVIĆ-PRIVRODSKI, R. I ALEKSIĆ i G. RACA


Institut za zdravstvenu zastitu dece i omladine, Novi Sad

 

Glavni cilj rada genetičkog savetovališta je predupređivanje rađanja osoba sa naslednim  bolestima  i  kongenitalnim  anomalijama.   U  cilju  procene koliko je teratogeno delovanje sredine izvršili smo analizu bračnih parova koji su u četvorogodišnjem periodu posetili genetičko savetovalište zbog delovanja štetnih noksi iz spoljne sredine u toku trudnoće. Od ukupno 955 bračnih parova, 362 se obratilo zbog eventualnog delovanja štetnih činilaca iz spoljne sredine. Zbog upotrebe lekova i rada sa štetnim hemikalijama javilo se 159 bračnih parova, što čini 16,75 % ukupnog broja žena koje su prošle kroz savetovalište. Od tog broja 30,82 % njih je uzimalo antibiotike, 17,6 % sedative i trankilanse, 13,8 % njih analgetike. Ređe su korišćeni antialergici, 6,28 %, antiepileptici, 4,4 %, hipnotici, 1,25 %. Lekovi koji se u ove grupe nisu mogli svrstati činili su ukupno 21,38 %. Zbog štetnih hemikalija, što su bile boje i lakovi javilo se 4,4 % žena. Infekcije u trudnoći ili kontakt sa infektivnim agensima dovelo je 127 žena (13,29 % ispitivane grupe. Najčešći uzroci javljanja zbog infekcija su rubeolla sa 15,74 %, varicella sa 14,96 % i herpes simpleks tip I sa 13,4 % slučajeva. Česta su gripozna stanja sa 18,11 % i druge infekcije (bakterijske upale guše, sinusa, mokraćnih puteva i pluća) sa 27,55 % slučajeva. Nije bilo slučajeva AIDS-a ni Hepatitis B infekcije. Zbog straha od izloženosti rendgentskom ili drugom zračenju javilo se svega 76 parova (7,96 %). Plod je direktno ozračen samo u slučaju snimanja karlične regije, što se dogodilo kod 22 žena (28,95 %). U odnosu na broj trudnica koji je prema literaturnim podacima izložen teratogenim činiocima, smatramo da bi i broj žena u savetovalištu sa ovim razlogom trebao da bude veći.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UPOTREBA SAVREMENIH SOFTVERA U DIJAGNOSTICI RETKIH SINDROMA

 

F. POPIĆ-PALJIĆ, A. KRSTIĆ, J. JOVANOVIĆ-PRIVRODSKI, G. RACA i R. ALEKSIĆ

 

Institut za zdravstvenu zaštitu dece i omladine, Novi Sad

 

Na Odeljenju za genetiku našeg Instituta koristimo u svakodnevnom radu dva softvera koji su načinjeni da služe kao pomoć u dijagnostici retkih sindroma. To su LDDB (London Dysmorphology Data Base) britanskih i POSSUM (Pictures of Standard Syndromes and Undiagnosed Malformations) australijskih autora. Način funkcionisanja ovih softvera je da im se unesu simptomi i znaci ispitanika, a oni na osnovu ponuđenih simptoma i znaka nude određen broj sindroma. Pošto je ponuđeni sindrom često nepoznat koristi se rečnik sindroma koji poseduje detaljan opis sindroma, podatke iz literature celog sveta sa referencama, primere bolesnika sa odgovarajućim sindromom i to u različitim uzrastima sa fotografijama bolesnika i njihovih rendgenskih snimaka. Dijagnoza se postavlja detaljnom analizom i poređenjem sopstvenog bolesnika sa ponuđenim od strane softvera. Pored rečnika sindroma, softver poseduje i rečnik simptoma. I jedan i drugi imaju značajnu ulogu u edukaciji. Kod našeg bolesnika rođenog 11.09.1986. godine u Bugojnu koji je hospitalizovan zbog deformiteta grudnog koša i čestih respiratornih infekcija postavljena je dijagnoza Spondylothoracic dysplasia-e zahvaljujući POSSUM-u. Na osnovu ponuđenih simptoma: postnatalni zastoj u rastu, nenormalan broj rebara (nedostaju rebra od 3-8), skolioza i nespušteni testisi, softver je ponudio dijagnoze: 1. Jarche-Levin syndrome (Spondilothoracic dysplasia) i 2. Simson-Colahi-Behmel syndrome. Pažljivim poređenjem sa znacima bolesnika opredelili smo se za dijagnozu Spondylothoracic dysplasia-e koja se nasleđuje autozomno-recesivno.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

FRAGILNA MESTA I ONKOGENI KAO MOGUĆI RIZIK ZA RAZVOJ NEOPLAZIJA KOD NOSIOCA BALANSIRANIH TRANSLOKACIJA

 

Branka POPOVIĆ, B. GARZIČIĆ i Biljana SPREMO

 

Institut za onkologiju i radiologiju Srbije, Laboratorija za kliničku i eksperimentalnu onkologiju, Beograd

 

Heriditarna teorija onkogeneze posmatra razvoj neoplazije kao mikroevoluciju, na nivou gena ili na nivou hromozoma. Jedan tip primarne transformacije ćelije pripada hromozomskim translokacijama (HGL. Burkitov limfom). Pošto primarne translokacije kod kancera obuhvataju recipročne translokacije u okviru fragilnih mesta, pitanje je da li su fragilna mesta rizik za razvoj kancera u humanoj populaciji. Specifikacijom mesta translokacija u odnosu na prisustvu onkogena i fragilnih mesta na hromozomima 1, 2, 6 i 7. kod 1000 konstitutivnih kariotipova sa balansiranom translokacijom i kod 100 kariotipova pacijenata obolelih od leukemije, uočava se podudarnost. U proseku 70 % translokacija je na fragilnim mestima, a 30 % na fragilnim mestima i onkogenima kod konstitutivnih kariotipova. Najveći deo primarnih translokacija kod neoplazija je na FRA i ONK, dok onkogeneza pokazuje mesta prekida na FRA ili van njih. Na osnovu različite fenotipske ekspresije mora se imati u vidu da se primarne translokacije sa malignom ekspresijom dešavaju na tačno određenom mestu u okviru ONK.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

INDUKCIJA FRAGILNIH MESTA NA HROMOZOMIMA ČOVEKA AFIDIKOLNOM I CITOZIN-ARABINOZIDOM

 

G. RACA, A. KRSTIĆ, B. GARZIČIĆ, F. POPIĆ-PALJIĆ, J.

JOVANOVIĆ-PRIVRODSKI, R. ALEKSIĆ, N. ČAMBER, R. MADŽAR, V.

ČIHI, Lj. GAĆINA, N. MITROVČAN i Lj. MALEŠEVIĆ

 

Sposobnost nuleozidnog analoga 1-beta-arabinofuranozyl cytosina da izaziva indukciju afidikolinskih (tip 4) fragilnih mesta u kariotipu čoveka dobro je poznata. Cilj rada bio je da se utvrdi da li pojedina fragilna mesta (u kategoriji afidikolinskih) pokazuju posebnu osetljivost na indukciju citozin-arabinozidom, odnosno da li postoji razlika u učestalosti ekspresije pojedinih fragilnih mesta u zavisnosti od toga da li se za indukciju koristi afidikolin ili citozin arabinozid. Dok je pri indukciji afidikolinom najveći stepen ekspresije dobijen za fra 3(p 14.2), fraX(p22) pokazalo se kao najosetljivije na indukciju citozin arabinozidom. Dobijene razlike mogle bi biti izraz razlika u molekularnom sastavu pojedinih fragilih mesta (bogatstvo GC parovima kod fragilnih mesta osetljivih na citozinarabinozid). Rezultati su posebno interesantni sa stanovišta činjenice da poznavanje molekularne strukture fragilnog X (amplikacija GC ostrvaca) otvara mogućnosti za traženje efikasnijih načina njegove indukcije i citogenetske dijagnostike, gde bi se kao jedna od supstanci-induktora ekpresije fragilnog X, mogao testirati i citozinarabiniozid.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PRIMENA METODA REKOMBINANTNE DNK U PRENATALNOJ DIJAGNOZI CISTIČNE FIBRIOZE

 

Dragica RADOJKOVIĆ 1, Ana SAVIĆ 2, J. SAVIĆ 1, P. MINIĆ l i B. BRUKNER-DABOVIĆ

 

1 Institut za zdravstvenu zaštitu majke i deteta Srbije, Beograd

2 Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Cistična fibrioza je autozomno recesivno oboljenje koje se javlja sa visokom učestalošću od 1:2500 rođene dece. Obolevaju osobe kod kojih je mutirani gen (CFTR) prisutan u homozigotnom stanju. Obzirom na težinu ovog oboljenja, kao i visok rizik (1:4) supružnika koji su heterozigotni nosioci mutiranog gena, za rađanje deteta obolelog od cistične fibrioze, prenatalna dijagnostika je od ključnog značaja. Prenatalna dijagnostika cistične fibrioze može se sprovoditi u prvom i drugom trimestru trudnoće, primenom metoda direktne i indirektne detekcije prisustva mutiranog gena. Direktna detekcija se sprovodi molekularno genetskom analizom na prisustvo definisanih mutacija u okviru CFTR gena (od kojih je najčešće delta F508 mutacija), dok se indirektna detekcija sprovodi praćenjem nasleđivanja mutiranog gena u porodici putem markera u blizini CFTR gena (RFLPs). Razvoj tehnika rekombinantne DNK, posebno reakcije lančanog umnožavanja DNK (PCR) omogućio je brzu prenatalnu dijagnozu cistične fibrioze u periodu od 48 časova. Prikazujemo naše slučajeve prenatalne dijagnoze cistične fibrioze primenom metoda rekombinantne DNK u prvom i drugom trimestru trudnoće, u cilju ilustracije mogućnosti, problema i pravilne strategije u prenatalnoj dijagnozi ove bolesti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RETKA VARIJANTA KARIOTIPA 47,XY, +13 U AML TIPA M2

 

S. RADULOVIĆ, Nada BARJAKTAROVIĆ i Vitana KOSTIĆ

 

Kliničko - bolnički centar "Zvezdara", Beograd

 

Prikazan je bolesnik star 74 godine, kod koga je postavljena dijagnoza ANLL tipa M2 na osnovu pregleda periferne krvi, koštane srži, citohemijskih bojenja i imunofenotipizacije. Citogenetska analiza je urađena pre uvođenja citostatske terapije i urađena je na 50 metafaza klasičnom tehnikom i tehnikom G-traka, pri čemu se pokazalo da se radi o trizomiji hromozoma 13 kao jedinom disbalansu hromozomskog seta. Ni numeričke ni strukturne promene ostalih hromozoma nisu zapašene. Prema literaturnim podacima hromozom 13 je veoma retko zastupljen u rearanžmanima kariotipa u AML, tako da je od posebnog značaja i sama konstatacija da je ova varijanta kariotipa povezana sa veoma lošom prognozom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POTOMSTVO NOSILACA RECIPROČNIH TRANSLOKACIJA U ZAVISNOSTI OD TIPA SEGREGACIJE, DISTRIBUCIJE I MESTA PREKIDA NA HROMOZOMIMA

 

O. RISTIĆ, Ž. LAĆA, S. NIKŠIĆ, N. ARANĐELOVIĆ i I. TIMOTIJEVIĆ

 

Institut za mentalno zdravlje, Beograd

 

U uzorku parova sa problemima fertiliteta, odabranih tokom petnaestogodišnjeg praćenja, otkriveno je 35 nosilaca recipročnih translokacija (RT), odnosno 2,2% (35/1567). Tip hromozomske segregacije je ustanovljen po modelu Jalbert-a i Sele-a (1980). Tip segregacije A-l je predviđen kod 88,5 %, tip A-2 kod 3 % i tip 3:1 kod 8,5 % recipročnih translokacija. U poređenju sa studijama iste problematike, tip segregacije 3:1 je statistički značajno manje zastupljen. Potvrda predviđenog i dobijenog tipa segregacije je dobijena kod svih slučajeva dostupnih pre/post natalnom ispitivanju. Hromozomi 2,4 i 21 su najučestaliji, što je u saglasnosti sa utvrđenim standardima. Međutim, hromozom 22 je manje zastupljen, čak i od hromozoma 21, odudarajući u distribuciji od nalaza u sličnim studijama. Pozicioniranje hromozomskih mesta prekida (MP) je ustanovljeno po Neri-u (1983), pri čemu su hromozomi podeljeni na terminalne (T), medijalne (M) i centromerne (C) segmente. Verovatnoća za dobijanje fenotipski normalnog i malformisanog potomstva je određena u odnosu na ukupan broj trudnoće živorođenu decu i pol nosioca recipročne translokacije. U odnosu na živorođenu decu, rizik za potomstvo sa nebalansiranim kariotipom je 14,3 %, a za fenotipski normalno je jednak, odnosno po 42,8 % i za normalni i za balansirani kariotip. Stopa spontanih pobačaja je 54,5 % u odnosu na ukupan broj trudnoća.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

FRAGILNA MESTA AFIDIKOLIN TIP A KAO CILJNE TAČKE DELOVANJA JONIZIRAJUĆEG ZRAČENJA

 

Biljana SPREMO i B. GARZIČIĆ

 

Institut za onkologiju i radiologiju, Laboratorija za kliničku i eksperimentalnu onkologiju, Beograd

 

Primena terapijskih doza jonizujućeg zračenja kod 13 pacijenata obolelih od Carcinom Porto Vaginalis Uteri (Ca PVU), dovodi do hromozomskih mutacija na T limfocitima periferne krvi. Promene obuhvataju prisustvo visokog procenta sledećih tipova hromozomskih aberacija: dicentričnih i heteroploidnih mitoza sa aberantnim hromozomima. Kvantifikacija hromozomskih aberacija tokom radioterapije pokazuje da povećanjem ukupno primljene doze zračenja, njihov procenat raste. Kvalitet hromozomskih rearanžmana utvrđen je korišćenjem tehnike G-traka na osnovu koje su detektovani regioni prekida na hromozomima koji su doveli do stvaranja dicentričnih hromozoma, kao najfrekventnijeg tipa aberacija. Pregledom prcko 1300 mitoza kod 13 pacijenata u toku radioterapije, pokazalo se da mesta prekida nisu slučajna. Prema Humanoj Genetskoj Mapi 10, najveći broj detektovanih prekida nalazi se na fragilnim mestima afidikolin tipa.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

LUPUS ANTIKOAGULANTNA ANTITELA/ANTITELA NA KARDIOLIPIN I KLINIČKE MANIFESTACIJE U SLE PACIJENATA I ČLANOVA NJIHOVE FAMILIJE

 

L.N. STOJANOVIĆ 1, E. L. NASSONOV 2 i M. STANIĆ 1

 

1 Institut za reumatologiju Akademije medicinskih nauka Rusije, Moskva

2 Institut za biologiju Medicinskog fakulteta, Beograd

 

Problem otkrivanja različitih imunih poremećaja kod normalnih članova familije pacijenata obolelih od sistematskog lupus critematodesa i porast obolelih od reumatičkih bolesti u ovim familijama je jedan od najtežih aspekata u razumevanju patogeneze SLE. Shvatajući porast interesovanja za lupus antikoagulante (LA), a podrazumevajući da postoji inhibitor antitela protrombinaznog kompleksa, uključili smo u studiju 5 probanta sa sigurnim SLE (2 muška, 3 ženska) svi LA pozitivnih. Probandi su bili stari od 23-34 godina sa trajanjem bolesti 2-20 godina (mean 8,4). U svih pacijenata nađen je povišen nivo anli-DNA, antikardiolipin antitela, a 3 su imala povišena ANA. Proučili smo 11 rođaka prvog stepena, kod kojih su nađeni sledeće simptomi: Raynod's fenomen (5), SLE (1 + 1), krioglobulinemični hemolitički sindrom (1), osteoartroza (1), ankilozni spondiloartritis (1), hipertenzija (1), 2 rođaka nisu imala nikakve kliničke simptome, ali je jedan imao laboratorijske promene. Takođe, smo pronašli laboratorijske poremećaje: 6 sigurnih i jedan nepotvrđen LA pozitivni rezultat od 10 urađenih, 3 sigurna pozitivna rezultata na kardiolipinska antitela i jedan nepotvrđen od 9 urađenih, kao i povišen nivo anti-DNA antitela (5), ANA (2), kriopriteina (1), reumatoidnih faktora (1). Dobijeni rezultati sugerišu korelaciju između različitih imunogenetičkih subtipova SLE i mogućnost pronalaženja i/ili kliničkih laboratorijskih promena u rođaka pacijenata obolelih od SLE. Podela pacijenata obolelih od SLE u ovakve subtipove može da bude korisno za profilaksu i prognozu u rođaka pacijenata SLE.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

CITOGENETSKI POKAZATELJI PRI TRETMANIMA U PERINATOLOGIJI


Nada TODOROVIĆ, B. LUKIĆ i Nada BARJAKTAROVIĆ


Kliničko - bolnički centar "Zvezdara", Beograd

 

U ovom radu su prikazani rezultati praćenja izmena sestrinskih hromatida (SCE) nakon primene Progestrona u trudnoći, Syntocinona u porođaju i Luminala i fototerapije u tretmanu hiperbilirubinemije novorođenčeta. U kontrolnoj grupi zdrave terminske novorođenčadi srednja vrednost SCE je 5,55±0,62. Rezultati naših ispitivanja su: posle Progresterona SCE=7,99 ± 0,88, a u in vitro eksperimentu i do 13,20±5,07. Posle primene Syntocinona ni u in vivo ni u in vitro sistemu nije bilo značajnog povećanja. Terapija Luminalnom takođe nije pokazala štetne efekte, srednja vrednost je bila 5,39±1,84, međutim, fototerapija novorođenčadi povećava nivo SCE na 7,66±2,18. Nakon ovih nalaza autori sugerišu visoku kritičnost pri davanju progesteronskih preparata u trudnoći i pažljivu procenu indikacija za primenu fototerapije kao i vreme njenog trajanja.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFIKASNOST PREPOZNAVANJA NEKOPLEMENTARNIH BAZNIH PAROVA

III. EFIKASNOST PREPOZNAVANJA NEKOMPLEMENTARNIH BAZNIH PAROVA U ETIOPLASTU

 

Desanka BOŽIN i Gordana CEROVIĆ

 

Institut za nuklearne nauke Vinča, Beograd

 

Hloroplasti i mitohondrije većine kopnenih biljaka imaju DNK koja se razlikuje od jedarne. Organele imaju svoju mašineriju za duplikaciju, transkripciju i translaciju. Činjenica je, međutim, da je većina proteina u hloroplastu kodirana u jedarnim genima, sintetizovana u citoplazmi i uvezena u hloroplast. Tek manji deo proteina hloroplasta je poreklom iz same organele. Ovi podaci nameću pitanja o organizaciji i informativnom sadržaju DNK hloroplasta. Studije mehanizama za održanje stabilnosti biljnog genoma za sada su još uvek ograničene na uklanjanje dimera pirimidina, popravku prekida DNK lanaca i uklanjanje grešaka uzrokovanih alkilirajućim agensima. Mi smo nedavno pokazali da u jedru Nicotiana tobaco funkcioniše mismečom stimulisan i za mismeč specifičan korekcioni sistem. Ovaj nalaz nam je nametnuo niz atraktivnih pitanja među kojima su: da li i u hloroplastu postoji i kako funkcioniše sistem za korekciju nekomplementarnih baznih parova? Da li je bliži bakterijskim ili jedarnom sistemu? Odgovor smo tražili u testovima mismeč specifične aktivnosti u ekstraktu iz etioplasta Triticum sp.. U eksperimentima je korišćen model sistem koji je opisan u prethodnim abstraktima. Sintetički oligonukleotidi pripremljeni su tako da formiraju C • A i C • C nekomplementarne bazne parove. Ustanovili smo mismečom stimulisanu i za mismeč specifičnu aktivnost u etioplastu Triticum sp., sa efikasnošću prepoznavanja: G:C <<< C • A << C • C. Ovi nalazi se razlikuju od rezultata koje smo registrovali u biljnom jedru.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFIKASNOST PREPOZNAVANJA NEKOMPLEMENTARNIH BAZNIH PAROVA

I. PREPOZNAVANJE NEKOMPLEMENTARNIH BAZNIH PAROVA U SISARSKOM JEDRU

 

Desanka BOŽIN, Gordana CEROVIĆ i RADMAN

 

Institut za nuklearne nauke Vinča, Beograd

Institut Jacques Monod, 2 place Jussieu, 75251 Paris Cedex 05, France

 

Mismeč je oznaka za nekomplementarne bazne parove koji nastaju u DNK dupleksu u toku DNK duplikacije, rekombinacije i deaminacijom 5-metalcitozina. Mehanizmi za korekciju ovakvih parova nastalih u toku DNK duplikacije dobro su proučeni kod E. coli, S. typhimurium i S. pneumoniae. Kod S. cercvisiae, nekih kičmenjaka i biljaka detektovani su slični korekcioni sistemi. Međutim, način na koji ovi sistemi funkcionišu još uvek je nedovoljno poznat. Zato smo "potražili" mismečom-stimulisanu i za mismeč specifičnu aktivnost u jedarnom ekstraktu iz folija jetre pacova. Za model sistem odabran je fragment dobro proučenog K-ras gena. Fragment odgovara okolini gly-12 kodona poznatog po čestim baznim supstitucijama (hot spot) i odabran je tako da gly-12 kodon bude u sredini. Serija jednolančanih 19-mernih oligonukleotida pripremljena je tako da su, posle hibridizacije odgovarajućih lanaca, u sredini DNK oligodupleksa formirani C • A G:A i C • C nekomplementarni bazni parovi. Elementarni dupleksi ligirani su u ligacionu lestvicu i korišćeni za testove detekcije nekomplementarnih baznih parova preko, njihovim prisustvom stimulisane, degradacije DNK u jedarnom ekstraktu iz ćelija jetre pacova. Registrovali smo mismečom stimulisanu i za mismeč specifičnu aktivnost, koja u uslovima fiziološkog pH ispoljava različitu efikasnost: G:C - G:A < C • C <<< C.A. Biohcmijska analiza segrerira aktivnosti homologe bakterijskim korekcionim sistema.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFIKASNOST PREPOZNAVANJA NEKOMPLEMENTARNIH BAZNIH PAROVA

II. EFIKASNOST PREPOZNAVANJA RAZLIČITIH KONFORMACIJA NEKOMPLEMENTARNOG BAZNOG PARA U SISARSKOM JEDRU

 

Desanka BOŽIN, Gordana CEROVIĆ i RADMAN

Institut za nuklearne nauke Vinča, Beograd,

Institute Jacques Monod, 2 place Jussieu, 75251 Paris Cedex 05, France

 

Tek nedavno je NMR i UV tehnikama utvrđeno da nekomplementarni bazni parovi imaju konformaciju i stabilnost koje zavise od pH uslova sredine u kojoj se nalaze. U cilju boljeg razumevanja mehanizma kojim se u ćeliji prepoznaje nekomplementarni bazni par u DNK, uradili smo test enzimatskog prepoznavanja različitih konformacija za CA, GA i CC nckomplementarne bazne parove u heterodupleksu koji odgovara sekvenci od 25-43 baznog para u K-ras genu. Utvrdili smo da postoji jasna razlika u efikasnosti prepoznavanja različitih konformacija jednog istog nekomplementarnog baznog para. Na pH 4.5, C:A, G:A i C:C bazni parovi su prolonirani, G:A ima GSyn: Aanti konformaciju i svaki bazni par je vezan sa dve vodonične veze. Enzimskim testom utvrdili smo efikasnost prepoznavanja protonirane forme ovih baznih parova: G:C = C:C - C:A < < G:A. Na pH 7.5, C • A, G:A i C • C bazni parovi nisu protonirani i nalaze se u neutralnoj formi. G:A par ima Ganti  Aanti konformaciju i dve vodonične veze. C • A i C • C. parovi vezani su samo jednom vodoničnom vezom. Enzimatskim testom utvrdili smo efikasnost prepoznavanja neutralne konformacije baznih parova: G:C = G:A < C • C <<< C • A. Ovo jasno pokazuje da nekomplementarni bazni parovi provociraju i utiču na svoju sopstvenu popravku.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UPOTREBA POLIMORFIZMA DNK U VISOKO POLIMORFNOM REGIONU (3'HVR) HUMANOG GENA ZA APOB U INDIKACIJI GENOMA

 

Sanja GLIŠIĆ, Ivana SAVIĆ i ALAVANIĆ

 

Institut za nuklearne nauke "Vinča", Laboratorija za radiobiologiju i molekularnu genetiku, Beograd

 

Polimorfizam hipervarijabilnog regiona (HVR) na 3' kraju gena za apolipoprotein B (apoB) predstavlja visoko informativan genetički marker, zbog visokog procenta heterozigotnosti (oko 80 %). Naši prethodni rezultati su pokazali da postoji 16 različitih alela ovog polimorfizma u beogradskoj populaciji. Hipervarijabilni region se nalazi oko 100 bp udaljen od drugog poliadenilnog signala i sastoji se od ponovaka koji se po pravilu javljaju u paru, dugom 30 bp. DNK je izolovan iz pune Krvi, osušene kapi krvi ili korena dlake. Izborom određenih oligonukleotida i optimalnih uslova za rad Taq polimeraze, dobijeni su specifični fragmenti DNK. Odgovori na postavljena pitanja o eventualnoj identifikaciji dobijeni su nakon elektroforeze na 1.5 % agaroznom gelu. Obzirom na diploidnu hromozomsku garnituru čoveka, kao i na kodominantno nasleđivanje ovih alela, moguća je laka, brza i relativno pouzdana identifikacija rodaka u prvom i drugom kolenu, dakle u slučajevima kada postoji ograničen broj osoba. Prikazana je upotreba ovog polimorfizma u sudskoj medicini u cilju pouzdanog utvrđivanja srodstva, kao i u drugim oblastima medicine, npr. u oceni uspešnosti transplatacije kostne srži, itd.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLIMORFIZMI DNK GENA ZA APOLIPOPROTEIN B (EcoRI i MspI) I NIVOI LIPIDA U SERUMU U NORMOLIPIDEMIČNE POPULACIJE SRBIJE; INTERAKCIJE RETKIH ALELA, PUŠENjA I NIVOA HOLESTEROLA

 

Sanja GLIŠIĆ, Ivana SAVIĆ i ALAVANTIĆ

 

Institut za nuklearne nauke "Vinča", Laboratorija za radiobiologiju i molekularnu genetiku, Beograd

 

Frekvenca polimorfizama dužine restrikcionih fragmenata gena za apolipoprotein B, detektovanih enzima EcoRI i MspI i njihov uticaj na nivo lipida u serumu, ispitivani su na 239 normalipidemičnih osoba sa područja Beograda. Takođe je ispitivan uticaj interakcija između različitih genotipova i pušenja. Relativna frekvenca oba retka alela, R2 i M2 (nedostatak rekostrukcionog mesta), slična je frekvencama utvrđenim u drugim grupama belc rase (0.16, odnosno 0.11). Nije uočena asocijacija između apo B genotipa/haplotipa i nivoa lipida u serumu podešenih za starosnu dob, telesnu težinu i krvni pritisak, u celom uzorku ili kod žena i muškaraca posebno. Kada su odvojeno ispitivani pušači i nepušači, pokazalo se da pušenje ima značajan uticaj na varijabilnost ukupnog holesterola kod svih osoba sa genotipom MlM2. Takođe, pušenje ima značajan uticaj na varijabilnost HDL holesterola kod žena sa genotipom R1R2. Nađeno je da prisustvo retkih alela ova dva polimorfizma kod pušača dovodi do sniženja nivoa lipida, kako u celom uzorku, tako i kod muškaraca i žena posebno analiziranih. Izuzetak je jedino povišenje nivoa HDL holesterola kod muškaraca pušača, heterozigota za EcoRl polimorfizam (R1R2).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VIŠEALELNI POLIMORFIZAM DNMK NA 3' KRAJU GENA ZA ApoB(HVR) INIVOILIPIDA U SERUMU KOD NORMOLIPIDIČNIH OSOBA

 

Sanja GLIŠIĆ, Ivana SAVIĆ i ALAVANTIĆ

 

Institut za nuklearne nauke "Vinča, Laboratorija za radiobiologiju i molekularnu genetiku, Beograd

 

Ispitivan je uticaj prisustva različitih alela hipervarijabilnog regiona (HVR) na 3' kraju gena za apolipoprotein B, glavnog proteinskog konstituenta, na nivoe lipida u serumu. Ispitivani uzorak sa područja Beograda sastojao se od 293 normolipidemične osobe (162 žena i 131 muškarac) izabranih po principu slučajnog odbira. DNK je preparovana iz pune krvi. Umnožavanje specifične sekvence rađeno je metodom in vitro amplikacije DNK (PCR, a dobijeni proizvodi reakcije analizirani na agaroznom gelu. Statistička analiza dobijenih rezultata rađena je vodeći računa o faktorima rizika kao što su dob, pol, pušenje, krvni pritisak ili telesna tczina. Nadeno je da u naSoj populaciji postoji 16 razoliCitih alela, Cija je veličina određena brojem ponovaka (od 26 do 54) sastavljenih od 15, pretežno A i T nukleotida. Najvišu frekvencu imaju aleli sastavljeni od 34 i 36 ponovaka (34HVR i 36HVR). U cilju ispitivanja asocijacija određenog genotipa sa varijacijom lipida u serumu, uzorak je podeljen u 6 grupa u zavisnosti od kombinacija alela, koji su jednaki, veći ili manji od 36 ponovaka (36HVR, >36HVR ili <36HVR). Pokazano je da polimorfizam DNK u ovom regionu ima značajan uticaj na varijaciju nivoa LDL holesterola kod žena. Uz to žene sa genotipom >36HVR/=36HVR imaju najviše vrednosti ukupnog i LDL holesterola, kao i triglicerida.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLIMORFIZAM DNK U SIGNALNOM PEPTIDU (INSERCIJA/DELECIJA) GENA ZA APOLIPOPROTEIN B

 

Sanja GLIŠIĆ, Ivana SAVIĆ, Nadežda RADOJA i ALAVANTIĆ

 

Institut za nuklearne nauke "Vinča", Laboratorija za radiobiologiju i molekularnu genetiku, Beograd.

 

            Signalni peptid humanog gena za apolipoprotein B (apoB) pokazuje polimorfizam, koji dovodi do različite dužine signalnog peptida. Obzirom da signalni peptid omogućava translokaciju kroz membranu endoplazmatičnog retikuluma, gubitak hidrofobnih aminokiselina bi mogao da utiče na proces translokacije apoB, i dalje na kolicinu lipoproteinskih čestica u krvi. Stoga je cilj rada na ovom polimorfizmu bio: 1. utvrditi postojanje ovog polimorfizma u ispitivanoj beogradskoj populaciji, broj alela i njihove frekvence, 2. ispitati da li postoji asocijacija ovog polimorfizma sa varijacijama u nivou lipida. DNK je izolovana iz pune krvi 237 normalipidemičnih i 52 hiperholesterolemične osobe. Upotrebom specifičnih oligonukleotida (IDI-5'CAGCTGGCGATGGACCCGCCGA3' i ID-2-5' ACCGGCCCTGGCGCCCGCCAGCA3') u reakciji in vitro lančane amplikacije (Polymerase Chain Reaction-PCR) u optimalnim uslovima za DNK sintezu, pomoću Tag polimeraze uz 10% DMSO, sintetisana su dva fragmenta. Duži fragment, koji ima 93bp i nosi informaciju za peptid dug 27 aminokiselina, označen je kao insercioni, Ins alel, a kraći od 84bp (za 24 aminokiseline) kao delecioni, Del alel. Vizuelizacijom na 8% poliakrilamidnom gelu nakon bojenja srebrom, u beogradskoj normolipidemičnoj populaciji detektovano je za 19.7-49% više heterozigota u odnosu na druge izučavane populacije, a time i više frekvenca Del alela. Međutim, statističke analize (χ2 test) su pokazale da ne postoje statistički značajne razlike u frekvencama oba alela normolipidemičnih osoba u odnosu na frekvence istih alcla kod 52 hiperholesterolemične osobe, kao ni između 6 podgrupa napravljenih u odnosu na visinu lipida u krvi normolipidemičnih osoba. Međutim, postoji tendencija povećanja frekvence Ins alela sa rastućim vrednostima lipidnog statusa. Ova linearna zavisnost frekvence Ins alela potvrđena je poređenjem sa osobama koje imaju vrednost LDL holesterola iznad normalnih.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EKSTRACELULARNE PROTEINAZE MEZOFILNIH LAKTOBACILA

 

Đ. FIRA, M. KOJIĆ, A. BANINA i Lj. TOPISIROVIĆ

 

Inslitut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Analizom većeg broja prirodnih izolata mezofilnih laktobacila identifikovani su određeni sojevi koji proizvode ekstracelularne proteinaze. Supstratna specifičnost ovih proteinaza je definisana u odnosu na glavne kazeinske frakcije (asi-,- and κ). Većina sojeva sintetiše kisele proteinaze koje predominantno hidrolizuju -kazein, sa izuzetkom soja Lactobacillus divergens 742 čija proteinaza hidrolizuje sve tri kazeinske frakcije uz optimalno delovanje na baznom pH. Sve testirane proteinaze su sestrinskog tipa, pošto je njihovo delovanje inhibirano odgovarajućim specifičnim inhibitorima (fenil metil sulfonil fluorid). U hibridizacionim eksperimentima pokazano je da totalna DNK izolovana iz ovih sojeva u najvećem broju slučajeva hibridizuje sa probama iz proteinaznog regiona laktokoka. Na osnovu hibridizacije sa ovim probama konstruisane su preliminarne restrikcione mape proteinaznih regiona određenih sojeva laktobacila, pri čemu je utvrđen visok stepen homologije sa proteinaznim regionima laktokoka. Među sojevima koji ne hibridizuju sa laktokokalnim proteinaznim probama, pored već pomenutog Lactobacillus divergens 742, interesantan je i soj Lactobacillus paracosei EN1, koji pored ekstracelularne proteinazne sintetiše i egzopolisaharid. Korišćenjem tretmana za čišćenje od prisustva plazmida dobijen je derivat ovog soja koji pored gubljenja sposobnosti sinteze egzopolisaharida pokazuje i povećanu proteolitičku aktivnost.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NUKLEOTIDNA SEKVENCA I TRANSKRIPCIONA ANALIZA NOV GENA ODGOVORNOG ZA REZISTENCIJU BAKTERIJE E. COLI K12 NA ANTIBIOTIK NOVOBIOCIN

 

Radmila V. IVANIŠEVIĆ, Mirjana M. MILIĆ, Dragana S. AJDIĆ, Milija Z. JOVIČIĆ, Mila J. JANKOVIĆ i J. SAVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo

 

Target antibiotika kumarina u bakteriji E. coli je giraza (GyrB subjedinica), enzim koji učestvuje u kontroli superspiralizacije bakterijske DNK. Najveći broj kumarin-rezistentnih mutacija mapira u gyrB gen (kodira GyrB protein). U našoj laboratoriji otkriven je nov genski lokus, koji utiče na odgovor bakterije E. coli K12 na novobiocin (Molecular Microbiology, 1992. 6: 1547-1553). Određena je nukleotidne sekvence nov genskog lokusa. Analiza nukleotidne sekvence pokazala je postojanje jednog "otvorenog okvira čitanja", dužine 1461 bazni par. Gen se "prepisuje" sa promotora koji prepoznaje subjedinica RNK polimeraze. Transkripcija počinje sa jednog od dva A nukleotida koji su udaljeni 6, odnosno 7 nukleotida od "10" regiona.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

REPLIKACIJA I MUTAGENEZA: ANALIZA VISOKO MUTABILNE SEKVENCE POREKLOM IZ hisC GENA BAKTERIJE E. COLI

 

Mila J. JANKOVIĆ, Mirjana M. MILIĆ, Radmila V. IVANIŠEVIĆ, Z. JOVIČIĆ i J. SAVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo

 

Naša ranija studija je pokazala da sojevi E. coli deficitarni za DNK polimerazu I pokazuju veoma snažnu mutatorsku aktivnost kao i da indukuju samo delecije i minus vanfazne mutacije. U okviru his gena locirano je vruće mesto za nastanak mutacija, monotoni niz od 4 GCTG kvadrupleta (Mol Gen Genet, 1990. 223:481-486). Analiza sekvence je pokazala da se u okviru ovog monotonog niza nalazi 4 puta ponovljen 3' GTC 5'triplet koji prepoznaje E. coli primaza. Moguća veza između DNK replikacije i visoke frekvence nastanka mutacija na ovom mestu ispitana je korišćenjem luzija relevantnog fragmenta iz hisC gena sa lacL genom. Do sinteze galaktozidaze dolazi samo ukoliko je nastala data vanfazna mutacija, a sekvenca koju prepoznaje primaza se u jednom slučaju nalazi na "leading" a u drugom na "lagging" lancu tokom replikacije plazmida.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

lieS i glnF MUTANTI E. coli POKAZUJU POVEĆANU REZISTENCIJU NA ANTIBIOTIK NOVOBIOCIN

 

Z. JOVIČIĆ, Mirjana M. MILIĆ, Radmila V. IVANIŠEVIĆ, Mila J. JANKOVIĆ i D. SAVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Novobiocin je kumarinski antibiotik koji inhibira enzimsku aktivnost GyrB subjedinice enzima topoizomeraze II. Topoizomeraza II je bakterijski enzim odgovoran za prevođenje cirkularnog molekula DNA u negativu superspiralizovanu formu. Poznato je da gyrB mutanti i neki cisteinski (cysB i cysE) mutanti pokazuju povećan nivo rezistencije na novobiocin (Mol Gen Henet, 1991. 228:307-311). Direktnom selekcijom na novobiocinskoj podlozi izolovani su novobiocin rezistentni auksotofi. Merenjem efikasnosti plejtovanja ishodnog soja i isoleucinskih i glutaminskih mutanata pokazano je da oni nemaju povišen nivo rezistencije na druge velike hidrofobne antibiotike. Mutacije u isooeucinskim i glutaminskim genima su mapirane PI transdukcionim eksperimentima. Glutainska mutacija mapira u glnF (rpoN) genu a isoleucinska mutacija u lieS genu glnF (rpoN) kodira subjedinicu RNA polimeraze a lieS gen kodira isoleucin-tRNA sintetazu. Komplementacijom isoleucinskih mutanata sa plazmidom koji nosi WT lieS gen takođe je pokazano da su mutacije u ovom genu odgovorne za novobiocinsku rezistenciju.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFEKAT BIOANTIMUTAGENA NA INTRAHROMOZOMALNU REKOMBINACIJU KOD Escherichia coli K12 J.

 

KNEŽEVIĆ-VUKČEVIĆ, B. ČULJKOVIĆ, M. VULOVIĆ, B. VUKOVIĆ-GAČIĆ i D. SIMIĆ

 

Katedra za mikrobiologiju, Institut za botaniku i Botanička bašta, Biološki fakultet, Univerzitet u Beogradu, Beograd

 

Glavni cilj istraživanja u oblasti antimutageneze/antikancerogeneze je detekcija supstanci koje inhibiraju ili moduliraju efekat genotoksičnih agenasa spoljašnje sredine i određivanje mehanizama njihovog antimutagenog/antikancerogenog dejstva. Postoje brojni podaci o antimutagenom efektu nekih prirodnih supstanci koje utiču na replikaciju i reparaciju DNK Rod bakterija i sisarskih ćelija. Aniimutageni mogu delovati na različite načine: hemijskom ili enzimatskom inaktivacijom mulagena (desmutageni) ili interakcijom sa ćelijskim procesima fiksiranja mutacija (bioantimutageni). Kratkoročni bakterijski test-sistemi koji se rutinski koriste za detekciju mutagena iz spoljašnje sredine, preporučeni su za identifikaciju antimutagena. Korišćenjem E. coli K12 test sistema, u prethodnom radu smo pokazali da među različito pripremljenim ekstraktima gajenja i samonikle žalfije (Salvia officinalis L.) samo CO1 reekstrakt gajene žalfije, pripremljen bez prethodne destilacije etarskih ulja (Ekstrakt 1), specifično redukuje frekvencu UV-indukovanih revizija u divljem soju. U ovom radu koristili smo seriju sojeva E. coli K12 sa različitim alelima recA gena da bi odredili da li je antimutageni efekat Ekstrakta i posledica stimulacije "error-free" rekombinacione reparacije. Merili smo intrahromozomalnu rekombinaciju između delecija lac operona koje se ne preklapaju praćenjem lac rekombinanata na McConkey-laktoza podlozi sa ili bez biljnog ekstrakta. Test sistem je proveren korišćenjem dva model bioantimutagena, kumarina i taninske kiseline, koji stimulišu rekombinacionu, odnosno ekscizionu reparaciju. Rezultati pokazuju da Ekstrakt 1 dovodi do povećanja broja lac rekombinanata u UV-ozračenim i u netretiranim recA i rec730 sojevima, pa je njegov antimutageni efekat najverovatnije rezultat stimulacije rekombinacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MOLEKULARNA ANALIZA VELIKOG PLAZMIDA pS50-290 SOJA Lactococcus laclis subsp. laclis biovar. diacetylactis

 

M. KOJIĆ, Lj. TOPISIROVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Lactococcus lactis subsp. laclis biovar. diacetylactis je prirodni izolat iz maslačne maje. Soj S50 sintctiše bakteriocin S50 uskog spektra delovanja i proteinazu Pl-tipa. Proteinazni geni, geni za sintezu i rezistenciju na baktcriocin nalaze se na plazmidu pS50-290 (290 kb). Ovaj poseduje još tri manja plazmida od kojih je najmanji veličine 7 kb (pS50-7). Plazmid pS50-7 je kriptičan, pošto derivat S50-20 (očišćen od plazmida pS50-7) ne menja svoje karakteristike rasta u poređenju sa originalnim sojem S50. Hibridizacioni eksperimenti (proba obeleženi pS50-7) su pokazali da se homologa sekvenca nalazi na plazmidu pS50-290. Ovi eksperimenti su takođe pokazali da i plazmid od oko 20 kb (pS50-20) poseduje homologu sekvencu plazmidu pS50-7. U konjugaciji S50 Rif, Bac+, Bacr (selekcija za rezistenciju na bacteriocin S50) u transferu plazmida pS50-290, dolazi najverovatnije do njegove rezolucije u rezultirajućem konjugantu MG10 na plazmide od oko 283 kb i 7 kb. Restrikcionom analizom plazmida od 7 kb izolovanog iz konjuganta MG10, pokazano je da ovaj poseduje identičan restrikcioni profil kao i plazmid pS50-7, prisutan u originalnom soju S50. PFGE plazmidne DNK soja S50 i konjuganta MG10, digerirane restrikcionim enzimom Smal in situ, pokazala je da plazmid pSO-290 poseduje dva Smal mesta, dok novonastali plazmid od 283 kb u konjugantu MG10, poseduje samo jedno Smal mesto. Drugo Smal mcsto je prisutno u plazmidu od 7 kb. Ovaj podatak potvrduje prctpostavku da sc radi o rezoluciji plazmida pS50-290 u konjugaciji na pomenute plazmide, a ne o kotransferu plazmida pS50-7 sa ovim plazmidom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

REGULACIJA EKSPRESIJE sgm GENA BAKTERIJE Micromonospora zionensis


KOJIĆ, TOPISIROVIĆ, Branka VASILJEVIĆ

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Proizvođač antibiotika G-52, bakterija M. zionensis, poseduje sgm gen koji kodira 16S rRNK metalizu čijom sc aktivnošću ostvaruje rezistencija na aminoglikozidne antibiotike. Ovaj gen ima složenu transkripcionu regulaciju sa dva promotora, PI i P2. Promotori PI i P2 su subklonirani u vektor pIJ486 koji omogućava selekciju promotora i pokazano je da je P2 promotor čctiri puta jači od PI promotora. Postojanje dva promotora različite jačine omogućava diferencijalnu gensku ekspresiju, pa je postulirana njihova različita funkcija kod proizvođača. Tako je predloženo da je slabiji PI promotor odgovoran za konstitutivnu ekspresiju sgm gena, dok je P2 zadužen za ekspresiju nizvodnih, biosintetskih gena u kasnijim fazama rasta kada otpočinje sinteza antibiotika. Pored regulacije na transkripcionom nivou, sgm gen pokazuje i regulaciju ekspresije na translacionom nivou. U ovom radu korišćene su sgm-lacZ genske fuzije za ispitivanje regulacije na translacionom nivou. Nivo ekspresije lacZ gena određivan je merenjem -galaktozidazne aktivnosti i pokazano je da transformanti koji imaju dodatnu kopiju sgm gena, bilo u cis ili trans poziciji, pokazuju izrazit pad -galaktozidazne aktivnosti, Ovi rezultati su pokazali da je ekspresija sgm gena autoregulisana translacionom represijom, najverovatnije zbog vezivanja metalize za sopstvenu iRNK. Kompjuterskom analizom sekvenci sgm gena i 16S rR, pokazano je postojanje jednog heksanukleotida koji se nalazi 14bp ispred RBS-a, dok se identičan heksanuklcotid nalazi u C-1400 regionu 16S rRNK, tj. u regionu gde većina metilaza odgovornih za rezistenciju na aminoglikozidne antibiotike ostvaruje svoje delovanje. Ovaj kompleksni vid regulacije ekspresije sgm gena omogućava da u ćeliji uvek bude dovoljno molekula metalize koja štiti bakteriju od dejstva sopstvenih antibiotika. S druge strane, ukoliko su svi ribozomi metilovani, sgm metaliza se vezuje za sopstvenu iRNK i na taj način sprečava svoju sintezu.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

TEHNOLOGIJA REKOMBINANTNE DNK U PATENTIRANJU BILJNIH VRSTA I ZAŠTITI AUTORSKIH PRAVA

 

Kosana KONSTANTINOV, Snežana MLADENOVIĆ, Snezana GOŠIĆ, G. SARATLIĆ, N. DELIĆ, R. PETROVIĆ

 

Institut za kukuruz, Zemun Polje, Beograd-Zemun

 

Primena tehnologije rekombinantne DNK u oblasti oplemenjivanja biljaka je od posebne koristi u patenetiranju novih biljnih genotipova i zaštiti autorskih prava. Ova tehnologija omogućava dobijanje osnovnih genetičkih informacija o postojećoj organizaciji genoma i identifikaciji specifičnih regiona u biljnom genomu. Molekularni genetički markeri, izoenzimi i RFLP i njihove kombinacije su veoma značajna metoda u identifikaciji gena, njihovoj lokalizaciji, ekspresiji i ukopčenosti što je ključni uslov u patentiranju i zaštiti autorskih prava u oplemenjivanju. Genske probe, rDNK, ZE-22, Cl, wx-8 i wx-9 su korišćene u analizi genoma linija i hibrida kukuruza. Dobijeni rezultati su ukazali polomorfnost tih lokusa i na jasne razlike između pojedinih fenotipova.   Kombinacija  izoenzimatske  slike i lokacije  gena će  se  koristiti  u konstrukciji "karte identiteta" biljaka. Postojeći polimorfizam biljnog genoma moguće je, primenom genske tehnologije izmeniti, integracijom stranih gena iz iste ili različitih biljnih vrsta, bakterija ili virusa. Ekspresija stranih gena i transmisija kroz generacije omogućava njihovo korišćenje kao genetičkih markera u identifikaciji i zaštiti novog genotipa. Posebno će biti prikazan novi pristup primene sintetičkih oligonukleotida u "obeležavanju" biljnog genoma.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

TEMPERATURNO ZAVISNA AKTIVNOST HIBRIDNIH ESCHERICHIA COLI PROMOTORA

 

KONSTANTINOVIĆ, Sanja IVKOVIĆ i GLIŠIN


Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Proučavan je uticaj temperature na aktivnosti dva hibridna E. coli promotora: tac (Dc Boer, 1982) i PLtI (Konstantinović et al. 1991.) koji imaju istovetne primarne strukture DNK u regionu - 35 - 10 i početka transkripcije, ali se razlikuju u uzvodnom redosledu nukleotida, tac promotor sadrži mesto za vezivanje lad represora dok PLtl sadrži sekvence za vezivanje lad i cl represora. Rezultati pokazuju da u zavisnosti od temperature, hemijski regulisan tac i hemijski i temperaturno regulisan PLtl promotor u fuziji sa lac reporter genom, pokazuju slične profile ali različite stepene aktivnosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

AKTIVACIJA ONKOGENA U PACIJENATA SA MIELOIDNOM NEOPLAZIJOM

 

Koviljka KRTOLICA, Nadežda UROŠEVIĆ, Dobrila NEŠIĆ, Ljiljana TUKIĆ, Z. MAGIĆ i B. DIMITRIJEVIĆ

 

Laboratorija za radiobilologiju i molekularnu genetiku, Institut za nuklearne
nauke "Vinča", Beograd, Institut za medicinska istraživanja i klinika za
hematologiju Vojno-medicinske akademije, Beograd.

 

Onkogeni su jedna od tri obimne klase gena čija izmenjena ekspresija doprinosi pretvaranju normalne ćelije u malignu. Pokazano je da je u ćelijama mieloidne loze, familija ras gena učestano mutirana, kao i da tek u kolaboraciji sa drugim onkogenima dolazi do potpune transformacije fenotipa. Cilj našeg istraživanja bio je ispitivanje aktivacije onkogena tačkastom mutacijom (N-ras i K-ras) ili amplifikacijom gena (N-ras, K-ras, c-myc, N-myc) u genomskoj DNK izolovanoj iz leukocita periferne krvi pacijenata obolelih od leukemije. Za detektovanje tačkaste mutacije korišćena je tehnika lančane reakcije polimeraze (PCR) i slot-blot hibridizacija, dok je amplifikacija gena ispitivana slot-blot ili Southern hibridizacijom. Analizom 4 mielodisplaziie (MDS), 23 akutne mieloidne leukemije (AML) i 11 hroničnih mieloidnih leukemija (CML) utvrđeno je da N-ras tačkasta mutacija preovlađuje (83 %) u odnosu na K-ras mutaciju (17 %). Amplifikacija c-myc gena od 5 do 10 puta, detektovana je kod 24 % pacijenata od kojih polovina ima istovremeno i jednu od ras mutacija. Sva četiri i MDS pacijenata nose neku od mutacija: amplifikaciju c-myc, K-ras ili N-ras onkogena ili tačkastu mutaciju na N-ras 12 kodonu. Prisustvo dvostruke mutacije utvrđeno je kod dva pacijenta. Ovi rezultati sugerišu da ko-operativni efekat ras i myc gena može da ima značajnu ulogu u patogenezi nekih od AML i MDS pacijenata.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENOTIPSKI-SPECIFIČNA AKUMULACIJA RAB17 iRNK U LISTOVIMA KUKURUZA TOKOM STRESA SUŠE

 

Vesna LAZIĆ-JANČIĆ, D. KOVAČEVIĆ, A. STEED i S.A. QUARRIE

 

Institut za kukuruz "Zemun Polje", Beograd-Zemun,

Cambridge Laboratory,AFRC-IPSR, JI Centre, Colney Lane, Norwich, NR4

 

Biljke odgovaraju na stres suše akumuliranjem abscisinske kiseline (ABA). Povišena koncentracija ABA, uglavnom, pomaže biljama da se adaptiraju na stres. Uvećava se broj RAB (Responsive to ABA) gena za koje je utvrđeno da mogu biti indukovani sušom. Koristeći genotipove kukuruza koji se razlikuju u kapacitetu za akumulaciju ABA u odgovoru na brzu dehidraciju, pokazali smo da postoji značajna korelacija između kumulacije RAB17 iRNK i sadržaja AB u dehidriranom listu. Granična vrednost sadržaja ABA za značajnu akumulaciju RAB17 iRNK iznosila je između 50 i 140 ng ABA/g sveže težine lista. na datom nivou ABA, genotipovi su se takođe razlikovali u količini te vrste iRNK.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ISPITIVANJE GENSKIH LOKUSA (QTL) ZA PRODUKCIJU ABSCISINSKE KISELINE POMOĆU RFLP MARKERA

 

Vesna LAZIĆ-JANČIĆ, C. LEBRETON, A. STEED i S.A. QUARRIE

 

Institut za kukuruz "Zemun Polje", Beograd-Zemun,

La Gourjonnierc, 35680 BAIS, France,

Cambridge Laboratory, AFRC-IPSR, JI Centre, Colney Lane, Norwich NR4

 

Identifikacija ciljnih molekula uključenih u korisne adaptivne odgovore na nivou cele biljke je cilj mnogih istraživačkih grupa koje rade na unapređenju adaptacije biljaka na stresne uslove spoljašnje sredine. Glavni biohemijski odgovor na široki spektar abiotičkih stresova, a naročito na stres suše je povećana produkcija hormona absicinske kiseline (ABA). Uglavnom, povećana koncentracija ABA u tkivima čini biljku bolje adaptiranom na nedostatak vode. Poznato je da se akumulacija ABA u delimično dehidriranim isečcima listova kukuruza nasleduje kvantitativno. Lokacija gena koji imam najveći uticaj na koncentraciju ABA kod kukuruza, određena je korišćenjem F2 populacije, koju čini 81 biljka dobijena ukrštanjem roditeljskih linija koje su se značajno razlikovale u sadržaju ABA pod različitim uslovima stresa (Polj 17 sa visokom ABA i F2 sa niskom ABA). Preliminarni podaci o mogućoj hromozomskoj lokaciji gena koji utiču na akumulaciju ABA, dobijeni su korišćenjem MAPMARKER-QTL i ANOVA kompjuterskog softvera. Upotrebljeno je oko 80 RTFLP markera koji su bili zastupljeni na svih 10 hromozoma. Značajni QTL za sadržaj ABA u listu i ksilemskom soku su locirani na svakom hromozomu osim na hromozomu 8. QTL sa najvećim uticajem na sadržaj ABA u listovima izloženim stresu locirani su na hromozomima 2 i 3 (lokusa). Oni se ne podudaraju ni sa jednim od za sadržaj ABA u ksilemskom soku a ni sa jednim QTL na hromozomu 2 za sadržaj u listu pod normalnim uslovima. Tri QTL (na hromozomima 1, 4 i 5) su bili više asocirani sa većim sadržajem ABA u biljama sa odgovarajućim alelom linije F2.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RADIJACIJOM INDUKOVANA EKSPRESIJA GENA ZA PROTEINE AKUTNE FAZE U JETRI PACOVA

 

Z. MAGIĆ, Svetlana MATIĆ i G. POZNANOVIĆ

 

Institut za medicinska istraživanja, VMA, Beograd

 

Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Jonizujuće zračenje na nivou DNK dovodi do različitih vrsta oštećenja (prekida lanaca, mutacija i oštećenja hromozoma). Međutim, rezultati novijih istraživanja su pokazali da jonizujuće zračenje može dovesti do aktivacije nekih gena eukariota. Ova aktivacija se odvija po određenom redosledu i u nju su uključeni i neki geni čiji produkti indukuju povećanu ekspresiju gena za proteine akutne faze Ovi proteini imaju važnu ulogu u odbrambenoj reakciji organizma na različite vrste povreda. Imajući u vidu ove činjenice, mi smo, nakon ozračenja celog tela pacova (Albino Oxford-AO inbredni mužjaci) sa apsolutno letalnom dozom gama zraka od 12 Gy pratili u plazmi ozračenih pacova promene koncentracije albumina (Al), fibrinogena (Fb), haptoglobina (Hp), inhibitora cistein proteaza (CPI) i i-kiselog glikoproteina (AGP). Takođe su merene (dot blot hibridizacijom odgovarajućih cDNK proba) promene relativnih koncentracija njihovih iRNK u jetri ozračenih pacova. Dobijeni rezultati su pokazali da ozračenje celog tela pacova sa 12 Gy dovodi do povećanja koncentracije Fb i Hp (2-3 puta u odnosu na kontrolne vrednosti) i naročito AGP i CPI (4-5 puta), dok se koncentracija Al uglavnom smanjuje ili se ne menja. Promene relativnih koncentracija iRNK u jetri ozračenih pacova za Al, Fb, menja. Promene relativnih koncentracija iRNK u jetri ozračenih pacova za Al, Fb, Hp i CPI su u korelaciji sa procenom njihovih koncentracija u plazmi. U slučaju AGP povećanje koncentracije iRNK nije tako izraženo kao povećanje koncentracije proteina u plazmi, što ukazuje da povećanoj koncentraciji AGP u plazmi ne prethodi povećanje transkripcije gena u jetri ozračenih pacova. Na osnovu dobijenih rezultata može se zaključiti da ozračenje celog tela pacova sa apsolutno letalnom dozom dovodi do povećane ekspresije gena za proteine akutne faze.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA iRNK SEMENA HELJDE U SAZREVANJU


Vesna MAKSIMOVIĆ, Svetlana RADOVIĆ, Erika VARKONJI i Ana SAVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Jedan od događaja koji karakteriše proces sazrevanja semena viših biljaka je tkivno i vremenski specifična ekspresija gena za rezervne proteine. U toku sazrevanja semena heljde, koje prosečno traje 30 dana, definisane su faze koje se jasno morfološki razlikuju i iz njih je izolovana poly A iRNK. Poly A iRNK translatovana je u sistemu pšenične klice za in vitro sintezu proteina u prisustvu 35S-metionina. Alikvoti translacionih smeša analizirani su elektroforezom na poliakrilamidnom gelu u denaturišućim uslovima. Analiza polipeptidnih produkata pokazala je da se iRNK za polipeptide koji čine glavni rezervni protein heljde, 13 S globulin, pojavljuju posle devetog dana sazrevanja od kada je sinteza ovih iRNK kontinuirana. Postojanje pojedinačnih iRNK za pojedinačne polipeptide složenog rezervnog proteina isključuje postojanje prekursorskih iRNK koja je uočena u ekspresiji gena za druge "leguminlike" rezervne proteine.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

67kD PROTEIN U MEMBRANI ERITROCITA BEOGRADSKOG ANEMIČNOG PACOVA

 

Jelena MARJANOVIĆ, V. GLIŠIN i Zvezdana POPOVIĆ

 

Inslitut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Nasledna mirkocitna, hipohromna anemija beogradskog laboratorijskog pacova (b/b) posledica je autozomalne mutacije. Transport gvozda kroz membranu retikulocita je poremećen. Elektroforetska analiza membranskih proteina eritrocita b/b pacova pokazala je da postoji dodalni protein molekulske mase 67kD "Western blot analize pokazale su da je ovaj protein prisutan samo u membrani b/b eritrocita. Najzastupljeniji protein u frakciji egzozomna i kontrolnih i b/b pacova ima istu molekulsku masu u SDS poliakrilamidnom gelu kao i dodatni protein u membrani eritrocita b/b pacova "Western blot" analiza potvrdila je da protein od 67kD iz membrane eritrocita b/b pacova ima išle antigene determinante kao i 67kD protein iz frakcije egzozoma. Inkubiranjem emulzije membrane bb pacova u prisustvu ATP dolazi do disocijacije 67kD proteina i proteina od 8OkD, za koji se pretpostavlja da je Protein 4.1. Otpuštanje proteina iz membrane eritrocita normalnih pacova pod istim uslovima nije detektovano. Dalje analize će pokazati vezu 67kD proteina i Proteina 4.1. kao i ATP-aznu aktivnost proteina od 67kb.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA REGULATORNOG DOMENA prt GENA Lactococcus lactis subsp. lactis BGIS29

 

N. MILADINOV, B. BOJOVIĆ, M. KOJIĆ, A. BANINA i Lj. TOPISIROVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Soj Lactococcus lactis subsp. lactis BGIS29 je prirodni izolat, dobijen iz sira proizvedenog u domaćinstvu. Poseduje veći broj plazmida od kojih je najveći broj kriptičan. Neki od plazmida determinišu sposobnost sinteze bakteriocina, rezistenciju na sopstveni bakteriocin, kao i sposobnost sinteze specifičnih proteinaza. Ovaj soj produkuje kiselu proteinazu Pl-tipa, koja hidrolizuju samo -kazein, sa temperaturnim optimumom od 30°C. Nađeno je da je proteinazni region, koji sadrži prtP i prtM gene, u soju BGIS29 lociran na velikom plazmidu veličine preko 130 kb. Izgleda da je organizacija gena u proteinaznom regionu soja BGIS29 slična istom regionu soja L. lactis subsp. cremoris Wg2, jer je restrikciona mapa proteinaznih regiona ova dva soja u velikoj meri slična. Jedina uočljiva razlika je što u regularnom domenu soja BGIS29 ne postoji ni jedno Clal mesto, dok soj Wg2 ima dva Clal mesta koja ograničavaju taj region. Promotorski region proteinaznih gena soja BGIS29 je umnožen PCR metodom pomoću prajmera PO4C-P15 poreklom iz soja L. lactis subsp. cremoris Wg2. Dobijeni PCR fragment je kloniran u vektor pBV5030 i elektroporacijom ubačen u E. coli C600 i L. lactis IL14CB. Hibridizacijom je potvrđeno uspešno kloniranje kao i da postoji nizak stepen homologije ovog regiona sa istim soja L. lactis subsp. cremoris Wg2. Ovaj rezultat potvrđuje zapaženu razliku u restrikcionoj mapi proteinaznih regiona sojeva BGIS29 i Wg2. Testom minimalne inhibitorne koncentracije (M1K) je pokazano da klonirani fragment poseduje promotorsku aktivnost kako u E. coli tako i laktokoka. Utvrđeno je da je fragment nestabilan u E. coli rec domaćinu i da je podložan delecijama i/ili drugim genskim rearanžmanima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NOVI cysB REGULISANI GEN KOJI UTIČE NA NOVOBIOCINSKU REZISTENCIJU cysB MUTANATA Escherichia coli

 

Mirjana M. MILIĆ, M.Z. JOVIČIĆ, Radmila V. IVANIŠEVIĆ, Mila J. JANKOVIĆ i J. SAVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

CysB protein je pozitivan regulator cisteinskog regulona koga čini 11 gena čiji produkti učestvuju u transportu sulfata, redukciji do sulfida i sintezi amino-kiseline cisteina. U našoj laboratoriji je otkriveno da cysB i cysE mutanti E. coli pokazuju povećanu rezistenciju na novobiocin, hidrofobni antibiotik čiji je primarni terget u ćeliji enzim giraza (Jasna Rakonjac, Mirjana Milić and Dragutin Savić; Mol. Gen. Genet. 1991. 228:307-311). U ovom radu je opisano otkriće novog gena koji je CysB regulisan a ne učestvuje u biosintezi cisteina. U otkrivanju ovog gena poslužio je sistem konstruisanja nasumičnih genskih fuzija uz korišćenje hibridnih faga a aktivnost fuzija je ispitivana na zavisnost od CysB proteina. Nađena je fuzija koja se aktivira u odsustvu CysB proteina a reprimira u prisustvu CysB proteina. Testiranje cysB mutanata sa ovom fuzijom na podlozi sa novlobiocinom pokazalo je da fuzija smanjuje rezistenciju cysB mutanata na novobiocin. Mapiranjem PI transdukcijama i Southern hibridizacijom utvrđeno je da ovaj gen mapira u blizini cysB gena. Gen je kloniran, a poređenje dela nukleotidne sekvence sa poznatim genima iz date base potvrdilo je da se zaista radi o novom genu E. coli.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ BAKTERIJSKIH GENA NA POLIMORFIZAM MULTIPLIH ALELA KUKURUZA

 

Snežana MLADENOVIĆ, Kosana KONSTANTINOV, Bojana TADIĆ i G. SARATLIĆ

 

Institut za kukuruz Zemun Polje, Beograd - Zemun

 

Unošenjem kodirajuće sekvence bakterijskog gena, koji kontroliše aktivnost neomicin fosfotransferoze (NPTII) u genom kukuruzu dobijene su transgene biljke sa različitim promenama fenotipa, koje su velikim delom eliminisane u toku redukcione deobe. Ranostasnost vezana za promenu visine biljke je indukovana mutacija koja je fiksirana u genomu biljaka T3 i T5 generacije. Integracija i ekspresija gena su utvrđene Southern analizom genomske DNK i određivanjem aktivnosti enzima NPTII. Standardnim analizama genotipa u 16 lokusa izoenzima su vršena ispitivanja uticaja integracije i ekspresije stranog gena na ekspresiju genoma domaćina. U tkivu koleoptila transgenih biljaka su utvrđene promene profila nekoliko analiziranih lokusa: Acpl, cp4, Mdhl, MdhS, bctaGIu, Idh2 i Pgm. Promene u lokusima Mdh3 i Mdh4 nisu utvrđene ni u jednoj od transgenih biljaka. Transgene bilje, dobijene iz originalne linije visoke generalne i specifične kombinacione sposobnosti su zadržale te osobine i u ukrštanjima sa standardima tester linijama kukuruza. Dobijeni rezultati pokazuju da bakterijski gen, integrisan u genom kukuruzu moze da izazove pojavu korisnih mutacija koje omogućavaju identifikaciju i lokalizaciju gena koji kontrolišu pojedine osobine kukuruza.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA DISTALNOG PROMOTORA bminy - GLOBINSKOG GENA PACOVA

 

Sonja PAVLOVIĆ, Tatjana MITROVIĆ, GLIŠIN i Zvezdana POPOVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Distalni promoter bminy - globinskog gena pacova koji je lociran uzvodno od prvog ATG kodona i obuhvata region od -100 do -900 baznih pacova, kloniran je u vektor pUC19 u obe orijentacije. Fragment je sekvenciran uz pomoć Sanger-ovog metoda za sekvenciranje. Utvrđivanje sekvence ovog regulatornog regiona omogućilo je komjutersko pretraživanje i upoređivanje sa cis sekvencama koje su otkrivene kod distalnih promotora globinskih gena drugih vrsta.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PROUČAVANjE REGULACIJE AKTIVNOSTI GENA ZA PENICILIN G AMIDAZU IZ Esherichia coli FUZIJOM SA DIVERGENTNIM REPORTER GENIMA

 

S. RADOJA, M. KONSTANTINOVIĆ i V. GLIŠIN

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Proučavanje primarne strukture i funkcije gena za penicilin G amidazu (pac iz Escherichia coli ukazalo je na postojanje kompleksne regulacije sinteze ovog enzima. Rezultati koji pokazuju da u blizini promotorskog regiona ovog gena postoji i antisens iRNK (Francetić, 1990) ukazuju na njenu moguću ulogu u regulaciji ekspresije. Plazmidni vektor pCB267 (K. Schneider and F.C. Beck, 1986) sa suprotno orijentisanim reporter genima, lacT (-galaktozidaza) i phoA (alkalna fosfataza) u fuziji sa različitim fragmentima DNK iz regulatornog regiona gena za pac iskorišćen je za proučavanje divergentnih promotorskih aktivnosti određenih fragmenata DNK. Pri različitim fiziološkim uslovima rasta ćelija domaćina merena je istovremeno obostrana aktivnost definisanih regiona DNK.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KARAKTERIZACIJA 13 S GLOBULINA SEMENA HELJDE

 

Svetlana RADOVIĆ, Vesna MAKSIMOVIĆ i Ana SAVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo

 

13 S globulin semena heljde, označen kao glavni rezervni protein ove biljke, izdvojen je iz ukupnog proteinskog ekstrakta centrifugiranjem u gradijentu koncentracije saharoze i gel-filtracijom na koloni Sephadex G-200. Ovako prečišćena proteinska frakcija analizirana je elektroforezom na poliakrilamidnom gelu (SDS) sa i bez prisustva 2-merkaptoctanola, čime su identifikovane pojedinačne polipeptidne subfrakcije. 13 S globulinska frakcija upotrebljena je za imunizaciju zečeva u čijem su serumu imunodifuzijom detektovana poliklonska anitetela. Dobijena antitela reaguju i sa proteinima semena Polygonum aviculare i ovsa (A. saliva), iako im se elektroforetogrami razlikuju. U toku sazrevanja semena heljde, koje prosečno traje 30 dana, 13 S proteinska frakcija je detektovana četrnaestog dana.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLIMORFIZAM DNK GENA ZA Apo AI-CIII (Sstl) INIVOILIPIDA U SERUMU KOD NORMOLIPIDEMIČNIH OSOBA

 

Ivana SAVIĆ, Sanja GLIŠIĆ, Nadežda RADOJA i D. ALAVANTIĆ


Institut za nuklearne nauke "Vinča", Laboratorija za radiobiologiju i molekularnu genetiku, Beograd

 

Polimorfizam duzina restrikcionih fragmenata gena za apo Al-CIII, detektovan enzimom SstI, ispitivan je da bi se utvrdilo da li aleli ovog polimorfizma utiču na nivo lipida. Uzorci krvi dobijeni su od 183 normolipidemične osobe sa područja Beograda. DNK je izolovana standardnim postupkom. Specifični region DNK je umnožen metodom in vitro DNK amplikacije (PCR) i podaci dobijeni restrikcionom analizom su statički obrađeni. Frekvenca retkog alela, S2, pokazala je linearnu zavisnost sa nivoima lipida u serumu. Utvrđeno je da muškarci nepušači sa genotipom S1S1, imaju značajno više nivo ukupnog i LDL holesterola, u odnosu na muškarce pušače sa istim genotipom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLIMORFIZAM DNK GENA ZA Apo B (Xbal) I NIVOI LIPIDA U SERUMU KOD NORMOLIPIDEMIČNIH OSOBA

 

Ivana SAVIĆ, Sanja GLIŠIĆ, Nadežda RADOJA i D. ALAVANTIĆ

 

Institut za nuklearne nauke "Vinča", Laboratorija za radiobiologiju i molekularnu genetiku, Beograd

 

Polimorfizam dužina restrikcionih fragmenata gena za apo B, detektovan enzimom Xbal, ispitivan je da bi se utvrdilo da li prisustvo različitih alela ovog polimorfizma ima uticaja na promene u nivou lipida. Uzorci krvi uzeti su od 230 normolipidemičnih osoba sa područja Beograda. DNK je izolovan standardnim postupkom. Specifični region DNK je umnožen metodom in vitro DNK amplikacije (PCR) i podaci dobijeni restrikcionom analizom su statistički obrađeni. Frekvenca retkog alela, X2, ukupno ispitanog uzorka, pokazala je linearnu zavisnost sa nivoima lipida u serumu. Utvrđeno je da muškarci sa retkim alelom, X2 , imam značajno nizi nivo HDL holesterola, u odnosu na muškarce sa alelom XI. Zene pušaci se genotipom X1X1 imaju značajno niži nivo HDL holesterola, u odnosu na žene nepušače sa istim genotipom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IZUČAVANjE MEHANIZAMA REPARACIJE KOD RAZLIČITIH PODVRSTA Bacillus thuringiensis

 

S. STANKOVIĆ, J. KNEŽEVIĆ-VUKČEVIĆ, B. VUKOVIĆ-GAČIĆ i D. SIMIĆ

 

Katedra za mikrobiologiju, Instituta za botaniku i Botanička bašta, Biološki fakultet, Univerzitet u Beogradu, Beograd

 

Bacillus thuringiensis, zemljišna, Gram pozitivna, štapićasta, fakultativno anaerobna bakterija, u toku sporulacije produkuje kristalne inkluzije. Po hemijskom sastavu ove inkluzije su proteini koji poseduju visoku i specifičnu insekticidnu aktivnost. Komercijalni preparati B. thuringiensis predstavljaju značajne biološke insekticide. Mehanizmi reparacije kod B. thuringiensis nisu dovoljno proučeni, ali postoje naznake da su slični mehanizmima koje poseduje Escherichia coli. Uočeno je prisustvo dva konstitutivna mehanizma reparacije, fotoreaktivacije i ekscizione reparacije. Pored toga, oštećenja na molekulu DNK izazvana dejstvom UV-zračenja, mitomicina-C ili aflatoksina B1 dovode do indukcije SOB funkcija kao što su filamentozni rast delija, indukcija profaga, Weigle-reaktivacija i Weigle-mutageneza. Uočavanje razlika u sposobnosti reparacije DNK kod različitih podvrsta može poslužiti kao osnova za dalje razjašnjavanje molekularnih mehanizama reparacije kod B. thuringiensis. U ovom radu smo pratili fotoreaktivaciju i filamentaciju ćelija nakon UV zračenja kod različitih podvrsta B. thuringiensis. Koristili smo laboratorijske sojeve B. thuringiensis ssp. kurstaki, HD1 i CryB i sojeve B. thuringiensis ssp. tenebraionis (BTT), ssp. berliner (BTB) i ssp. israelensis (BTI), izolovane iz komercijalnih preparata. Rezultati dobijeni praćenjem osetljivosti na UV-zračenja pokazuju da postoji sličnost između HD1, BTT i BTI, dok je soj BTB osetljiviji. Otpornost na UV zračenje uočena je kod soja CryB. S obzirom da soj ryB ne sadrži plazmide, moguće je da njihovo odsustvo uslovljava povećanu otpornost na UV zračenje. Poređenjem fotoreaktivacije primećeno je da ovaj proces ima najveći efekat kod sojeva osetljivih na UV-zračenje. Kod ovih sojeva uočeno je 10 puta veće preživljavanje ozračenih ćelija nakon osvetljavanja vidljivom svetlošću. Rezultati dobijeni praćenjem filamentoznog rasta ćelija biće prikazani.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KLONIRANJE I KARAKTERIZACIJA HUMANOG SOX3 GENA

 

Milena STEVANOVIĆ 1 i P.N. GOODFELLOW 2

 

1 Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd,

2 Department of Genetics, University of Cambridge, Downing Street, Cambridge, UK.

 

Kloniranje gena za determinaciju pola dovelo je do otkrića nove familije gena. Ovi geni su nazvani SOX geni i pokazano je da je ova nova genska familija kod čoveka mnogobrojna i da obuhvata najmanje 20-ak srodnih gena. Karakterizacija SOX gena je pokazala da se ovi geni eksprimiraju u toku embrionalnog razvića u neuralnim i srodnim tkivima i ukazala da ovi geni verovatno funkcionišu kao regulatori razvića centralnog nervnog sistema. Humani SOX3 gen je kloniran pretraživanjem kozmidne biblioteke sortiranih X hromozoma i korišćenjem somatskih ćelijskih hibrida gen je mapiran na X hromozomu u regionu Xq26-27. Hromozomska lokacija, kao i simptomi opisani kod pacijenata kod koga je SOX3 gen deletiran, su pokazali da je ovaj gen kandidatni gen za Borjenson-Forsman_Jehman sindrom mentalne retardacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IZUČAVANjE STABILNOSTI PLAZMIDA pAl BAKTERIJE Lactobacillus plantarum A112

 

I. STOJANOVIĆ, M. VUJIČIĆ i Lj. TOPISIROVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Plazmid pAl (2820 bp) predstavlja najmanji od četiri plazmida soja Lactobacillus plantarum A112. Ovaj plazmid se replikuje mehanizmom kotrljajućeg obruča. Analizom njegove sekvence utvrđena su tri potencijalna okvira čitanja za proteine: RepA, RepB i skraćenu verziju Mob proteina. Da bi se odredilo da li se plazmid pAl može replicirati u širem spektru domaćina, konstruisana su dva plazmida pAl-1 (4.7 kb) i pAl-6 (3.6 kb). Oba konstrukta nose crm gen (korira rezistenciju na eritromicin), a razlikuju se po tome što plazmid pAl-6 ne poseduje RSA sekvencu. Uspešna transformacija drugog laktobacila Lb. plantarum NCDO193, kao i E. coli i Lociococcus laciis pokazala je da plazmid pAl poseduje sposobnost replikacije nehomologim domaćinima. Segregaciona stabilnost plazmida pAl-1 i pAl-6 je prilično visoka u Lb. plantarum NCDO1193 i L. lactis IL1403 (preko 90 % ćelija raslih u neselektivnim uslovima zasdržava plazmid i posle 60 generacija). Nasuprot tome, segregaciona stabilnost u E. coli rcaA soju je znatno niža (posle 60 generacija, samo 1 % ili 40 % ćelija zadržava plazmid pAl-1 odnosno pAl-6). Pošto recA genotype potencijalno može biti uzrok nestabilnosti plazmida usled akumulacije jednolančane DNK u ovom domaćinu, segregaciona stabilnost je praćena u izogenom recA i recA paru sojeva E. coli. Plazmid pAl-1 zadržava visok nivo segregacione nestabilnosti u oba rec derivata, dok plasmid pAl-6 ne pokazuje signifikantnu razliku u segecgacionoj stabilnosti u bilo kom rec derivatu. Ovo ukazuje na moguću ulogu RSA sekvence u replikacionoj stabilnosti plazmida, koja treba da se definiše.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA I BIOHEMIJSKA KARAKTERIZACIJA BAKTERIOCINA BAKTERIJE Laclobacillus casei subsp. pseudoplantarum BGUB9

 

J. SVIRČEVIĆ, M. KOJIĆ, A. BANINA i Lj. TOPISIROVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd.

 

Bakteriocini su jedinjenja proteinske prirode sa bakteriocidnom ili baktcriostatičnom aktivnošću koja je ograničena na srodne vrste. Prirodni izolat bakterija mlečne kiseline Lactobacillus casci subsp. pseudoplantarum BGUB9 proizvodi baktericin UB9 uskog spektra delovanja (inhibira rast bakterije Lactobacillus casci BGHN14). Bakteriocin UB9 je termostabilan (30 minuta na 100 pC), aktivan u opsegu pH od 1-10, delimično ga inaktivira hloroform, a potpuno ga inaktiviraju proteinaze (pronaza E, proteinaza K, pepsin, tripsin i -hemotripsin). Sinteza bakteriocina započinje nakon petog sata rasta bakterijske kulture BGUB9, a najintenzivnija je između 12-16 sati. Molekulska masa bakteriocina UB9 je određena pomoću SDS-poliakrilamid gel elektroforeze (SDS-PAGE) i iznosi 6500-7 Da. U cilju određivanja lokacije gena za sintezu bakteriocina (hromozomalna ili ekstrahromozomalna lokacija) primcnjeno je CiSccnje plazmida. Tretman novobiocinom (10 g/ml) i povišenom temperaturom (42°C) je dao visoku frekvencu Bac varijanti (35.%). Svi Bac derivati su i senzitivni na bakteriocin UB9). Plazmidni profil Bac soja BGUB9 i ocišćenog Bac soja BGUB9-16 je isti, pa se planira analiza ovih sojeva na PFGE.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EKSPRESIJA GENA ZA ALBUMIN I a-FETOPROTEIN U JETRI AO PACOVA NAKON HEPATEKTOMIJE I VIŠEKRATNOG ZRAČENjA

 

Nataša TRUTIĆ, Koviljka KRTOLICA, M. ČOLIĆ i Z. MUGIĆ

 

Institut za hemiju, Medicinski fakultet, Niš,

Laboratorija za radiobiologiju i molekularnu genetiku, Institut za nuklearne nauke "Vinča", Beograd

Institut za medicinska istraživanja, VMA, Beograd.

 

Albumin je najzastupljeniji protein plazme nakon rođenja, sa mnogobrojnim funkcijama neophodnim za održavanje homeostaze. Pojava a-fetoproteina u odraslih ukazuje na prisustvo malignog procesa u organizmu, pre svega u jetri. Zbog toga je odnos ekspresije gena za ova dva proteina pouzdan pokazatelj funkcionalnog stanja jetre. Hepatektomija uzrokuje povećanje metabolizma jetre koje je praćeno ranom proliferacijom DNK i hepatocita, dok visoke doze jonizujućeg zračenja, pre svega, uzrokuju oštećenje DNK. Eksperimenti su rađeni na inbrednim pacovima AO (Albino Oxford) soja, koji su podvrgnuti parcijalnoj hepatektomiji (30-40%) ili frakcionisanom ozračenju celog tela sa gama zracima (13 Gy u pet dnevnih doza). Ukupna RNK je izolovana iz jetre pacova 6, 12, 24, 48, 72 i 96 časova nakon traume. Relativna koncepcija iRNK za albumin i a-fetoprotein je određivana slot-blot hibridizacijom RNK sa odgovarajućim cDNK probama koje su obeležene niktranslacijom sa 32P-dTCP. Dobijeni rezultati su pokazali da hepatektomija, naročito u periodu od 24-72 časa posle povrede, dovodi do značajnog smanjenja koncentracije (20-25%) iRNK za albumin. Nakon radijacione povrede ove promene nisu tako izražene. Smanjenje ekspresije gena za albumin nakon traume je jednako pouzdan pokazatelj tzv. akutno-fazne reakcije organizma na povredu, kao što je povećanje ekspresije gena nekih drugih proteina, pošto on spada u grupu "negativnih" proteina akutne faze čija se koncentracija smanjuje nakon dejstva traumatskog agensa. Za razliku od albumina čija je relativna koncepcija iRNK najveća u odraslih intaktnih pacova, koncentracija iRNK za a-fetoprotein u odraslih jedinki je praktično nemerljiv, ali je zato u fatalnoj jetri njena koncentracija više desetina puta veća.

Hepatektomija, ali ni zračenje nisu doveli do povećanja relativne koncentracije iRNK za a-fetoprotein u jetri pacova što je ukazalo da obe povrede u ispitivanom periodu uzrokuju samo funkcionalnu aktivaciju ćelija jetre.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IZUČAVANJE REZISTENCIJE NA HIGROMICIN B U SOJEVIMA RODA MICROMONOSPORA

 

Branka, M. KOJIĆ Lj. TOPISIROVIĆ


Inslitut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Sojevi roda Micromonospora koji proizvode aminoglikozidne antibiotike pokazuju visok nivo rezistencije na 4,6-disupstituisane dczoksistreptaminske antibiotike koji su po strukturi slični njihovim sopstvenim proizvodima. S druge strane, ovi sojevi su senzitivni na 4,5-disupstituisane dezoksistreptamine i na streptomicin. Iznenađujuće je da su svi ovi sojevi rezistentni i na higromicin B, antibiotik koji ima drugačiju hemijsku strukturu. Za razliku od sojeva koji proizvode antibiotike, M. melanosporea je soj koji ne proizvodi nijedan antibiotik i senzitivan je na sve testirane antibiotike uključujući i higromicin B. Do sada su klonirana dva gena odgovorna za rezistenciju u proizvođačima i to su grm iz M. purpurea i sgm iz M. zionensis. Oba ova gena su eksprimirana u S. lividans, E. coli i M. melanosporea. Interesantno je da ekspresija ova dva gena u S. lividans i E. coli dovodi do identičnog odgovora na aminoglikzozidne antibiotike kao i u originalnom domaćinu, s tim što su oba soja senzitivna na higromicin B. Za razliku od ova dva domaćina, transformanti soja M. melanosporca koji nose bilo grm ili sgm gen, pokazuju pored rezistencije na 4,6-disupstituisane dezoksistreptamine i rezistenciju na higromicin B. Pošto se radi o genima koji kodiraju specifične 16S rRNK metalize, zaključeno je da metilacija 16S rRNK samo u soju M. melanosporea omogućava rezistenciju na higromicin B. Na ovaj način je pokazano da je visok nivo rezistcncije na higromicin B zaista determinisan genima odgovornim za rezistenciju na aminoglikozidne antibiotike (grm i sgm), ali da je ispoljavanje ove rezistencije zavisno od soja u kome se ovi geni eksprimiraju. Ova činjenica ukazuje na određenu specifičnost u strukturi 30S subjedinice sojeva roda Micromonospora. Da bi se detaljnije utvrdila veza između specifične metilacije 16S rRNK i rezistencije na higromicin B, u soj M. melanosporea su uvedeni i drugi geni odgovorni za rezistenciju na aminoglikozidne antibiotike klonirani iz srodnih bakterija.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ELEKTROHROMOZOMSKA REPLIKACIJA PLAZMIDA U EMBRIONIMA VINSKE MUŠICE

 

Miloš VUJANAC, Vesna TODOROVIĆ, Snežana KOJIĆ, Ana SAVIĆ i Dragana STEFANOVIĆ

 

Brojni rezultati ukazuju na značaj SAR elemenata DNK (Scaffold Attachment Regions - fragmenti DNK vezani za nukleusni metriks) u hromozomskoj i ekstrahromozomskoj replikaciji DNK. Mi smo pretpostavili da delovi DNK bogati A-T parovima mogu da služe kao SAR elementi i tako poboljša zadržavanje plazmida u jedru i njegovu sposobnost da se ekstrahromozomski replikuje u ranim embrionima vinske mušice. Da bi testirali ovu pretpostavku, konstruisali smo seriju pGEM plazmidnih vektora koji sadrže fragmente različite dužine bogate A-T parovima. Zajedno sa vektorom svaki konstrukt je elektroporacijom uvođen u embrione vinske mušice. Posle nekoliko ćelijskih ciklusa iz embriona je izolovana DNK, podeljena je u dve porcije u svaka porcija je sečena restrikcionim enzimom Dpn I ili Mbo I. Oba enzima prepoznaju istu sekvencu DNK, ali Dpn I seče samo metilovanu DNK (replikovanu u bakterijama) dok Mbo I seče samo nemetilovanu DNK (replikovanu u embrionima). Sečena DNK je uvođena u bakterije i određivana je proporcija plavih kolonija (koje sadrže vektor) i belih kolonija (koje sadrže vektor sa insertom) u svakom uzorku. Naši rezultati potvrđuju važnost SAR elemenata u replikaciji DNK.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA PLAZMIDA pMZ1 IZ BAKTERIJE Micromonospora zionensis

 

Nataša VUKOV, Snežana KOJIĆ, Lj. TOPISIROVIĆ i Branka VASILJEVIĆ

 

Institut za molekularnu genetiku i genetičko inženjerstvo, Beograd

 

Plazmid pMZl, veličine 9,9 kb, izolovan je iz soja M. zionensis. Određena je restrikciona mapa ovog plazmida i različita restrikciona mesta su korišćena za ubacivanje selektivnog markera. Kao selektivni market korišćen je tiostreptonski gen iz plazmida pIJ702. Da bi se analizirao što veći broj mesta u koje je moguće ugraditi selektivni marker, korišćen je i Sau3Al enzim za digestiju pMZl plazmida. Pokazano je da je od 15 potencijalnih Sau3AI restrikcionih mesta, moguće ugraditi tiostreptonski gen samo na dva mesta, što ukazuje na to da se ostala restrikciona mesta nalaze u regionima značajnim za replikaciju ovog plazmida. Slični rezultati su dobijeni i prilikom konstrukcija himernih plazmida za koje je korišćen plazmid pIJ702. Himerni plazmidi su dobijeni samo prilikom integracije večeg dela pIJ702 plazmida u jedinstveno BamHI mesto (pMSl/2), odnosno u jedno od dva Bell mesta (pMS3/l). Da bi se dobio uvid u moguće ORF regione na plazmidu, klonirani su Womotorski fragmenti pomoću vektora za kloniranje i selekciju promotora pIJ4S7. Fragment! kopije su davali promotorsku aktivnost su korišćeni kao probe u hibridizacijom eksperimentima na osnovu kojih je pokazano da se svi klonirani promotori nalaze u tri različita regiona ovog plazmida. u cilju detaljnije analize ovih regiona izvršeno je njihovo subkloniranje u pUC19, Sto je dalo mogućnost da se odredi sekvenca ovih fragmenata.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MOGUĆNOST SELEKCIJE Digitalis lanola Ehrh. I Datura innoxia Mill. NA POVEĆAN SADRŽAJ AKTIVNIH MATERIJA

D. S. ADAMOVIĆ, B. PEKIĆ i Z. LEPOJEVIĆ

 

Institut za ratarstvo i povrtarstvo, Tehnološki fakultet, Poljoprivredni fakultet, Novi Sad

 

Vunastsi digitallis (Digitalis lanata Ehrh.) je u farmaciji još uvek nezamenljiva sirovina za izolaciju glikozida koji se koriste u terapiji obolelog srca. Ranija istraživanja su pokazala da se digitalis može uspešno gajiti u našim agroekološkim uslovima. Kako je sadržaj dominantnog glikozida (lanatozid C) u proizvedenoj sirovini bio relativno nizak i varijabilan, pristupilo se selekcionom radu. Dobijeni rezultati su pokazali da je moguće početni sadržaj lanatozida C od 0,2% posle dva ciklusa individualne selekcije, povećati u proseku na 0,31%. Kod pojedinih odabranih biljaka zabeležen je sadržaj lanatozida C u suvom lišću iznad 0,4%. Buduća istraživanja će pokazali da li je moguć dalji napredak u pravcu povećanja sadržaja lanatozida C, kao i kakva je njegova stabilnost kod ove dvogodišnje lekovite vrste. Indijanska tatula (Datura innoxia Mill.) je važna sirovina za izolaciju alkaloida skopolamina, koji se široko koristi u farmaceutskoj industriji. U preliminarnim istraživanjima je pokazano da se tatula može uspešno gajiti u našem podneblju. U cilju povećanja ekonomičnosti izolovanja skopolamina otpočet je selekcioni rad na povećanju njegovog sadržaja u nadzemnoj masi (herba). Primenom individualne selekcije u tri ciklusa sadržaj skopolamina je povećan sa 0,17% na prosečno 0,32%. Kod pojedinih biljaka skopolamin je bio zastupljen i iznad 0,5%. Naročito je značajno da je kod odabranih perspektivnih potomstava prisutan skoro isključivo skopolamin, dok su drugi alkaloidi zastupljeni u vrlo maloj količini ili samo u tragovima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NAČIN NASLEĐIVANjA I EFEKAT GENA ŽETVENOG INDEKSA I PRINOSA ZRNA PO BILJCI KOD KUKURUZA (Zea mays L.)

 

J. BOĆANSKI, M. STOJAKOVIĆ

Institut za ratarstvo i povrtarstvo, Novi Sad

 

U ova istraživanja uključeno je šest različitih inbred linija. Inbred linije su međusobno dialelno ukrštene i proizvedeno je 15 F1 hibrida. Za ocenjivanje načina nasleđivanja primenjen je test signifikantnosti srednjih vrednosti generacija u odnosu na roditeljski prosek (Borojević, 1965). Efekat gena urađen je po metodu Jinksa (1954) i Haymana (1954). Kod nasleđivanja žetvenog indeksa radi se o superdominaciji kod većine hibrida, a kod tri kombinacije utvrđena je puna dominacija. Za žetveni indeks dominantna komponenta genetičke varijanse je veća od aditivne, što znači da glavni deo genetičke varijanse pripada dominantnoj komponenti u nasleđivanju ovog svojstva. Pošto je vrednost F pozitivna, može se zaključiti da u ekspresiji žetvenog indeksa preovlađuju dominantni nad recesivnim genima. Prosečan stepen dominacije je veći od 1, što potvrđuje da kod nasleđivanja žetvenog indeksa radi o superdominaciji uzevši u obzir sve kombinacije. Kod nasleđivanja prinosa zrna po biljci kod svih kombinacija ukrštanja utvrđena je superdominacija. Analiza komponenti genetičke varijanse pokazuje da je dominantna komponenta varijanse znatno veća od aditivne tj. da se radi o interakciji gena za prinos zrna po biljci. Vrednost F je ncgativna Sto znaCi da su prcovladivali recesivni u odnosu na dominantne alele. Pošto je izračunata vrednost prosečnog stepena dominacije veća od jedinice, radi se o superdominaciji u nasleđivanju prinosa zrna po biljci.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

METODE OCENE ADITIVNE GENETSKE KOMPONENTE NASLEĐA

 

V. BOGDANOVIĆ 1, D. RADOJKOVIĆ 1, Radica VIDIĆ-DEDOVIĆ l i P. STOJIĆ 2

 

1 Poljoprivredni fakultet, Beograd – Zemun

2 Zavod za stočarstvo i veterinarstvo, Agroekonomik, Beograd

 

Aditivni efekat gena predstavlja onaj efekat gena koji se ispoljava nezavisno od efekata drugih gena u genotipu, koji se jedini sigurno prenosi na potomstvo i koji se određenim metodama može vrlo precizno oceniti. Iz tih razloga, ovaj efekat kao deo ukupne nasledne komponente, u savremenoj zootehnici ima ogroman značaj, jer na najbolji način oslikava priplodnu vrednost ispitivane individue. Zbog svega iznetog, danas se ubrzano radi na iznalaženju najprilagođenijih matematičko - statističkih metoda za ocenu aditivnog efekta, kao i za rangiranje priplodnih životinja. Današnji visok nivo intenziteta stočarske proizvodnje posledica je genetskog napretka ostvarenog prvenstveno korišćenjem superiornih priplodnjaka, primenom adekvatne tehnologije gajenja, kao i razvojem moćnih kompjuterskih sistema koji su omogućili uključivanje velikog broja do tad neiskorišćenih informacija, a koje imaju veliki značaj za dobijanje konačne ocene. Sve ove prednosti su uslovile početak postepenog zamenjivanja do skoro korišćenih jednostavnijih metoda ocene aditivne genetske komponente (prosek; komparacija kćeri - majke; poređenje kćeri - vršnjakinje, tzv. CC - metod (Robertson & Rendal, 1950.) i modifikovani CC, tzv. MCC - metod (Norman, 1976.) i prelazak na složenije i efikasnije metode, kao što su: selekcijski indeksi (SI za životinje razvio je Hazel, 1943., a šira teorijska razmatranja dali su Cochran, 1951. i Henderson, 1963.); metod najmanjih kvadrata (LSM je razvio Yates, 1930., a modifikaciju su izvršili Henderson i sar. 1948., 1953., 1959. i 1963.); metod najboljih linearnih pokazatelja (BLUP; Henderson, 1963. i 1973.); metod ocene individualne intrapopulacijske priplodne vrednosti ili animal model (Henderson & Quass, 1976.) i redukovani animal model (Quass & Follak, 1980.).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ SPOLJNIH USLOVA NA OTPORNE HIBRIDE PŠENICE PREMA PUCCINIA RECONDITA TRITICI KOD MODELIRANJA UZAJAMNIH GEN-ZA-GEN ODNOSA

Jelena BOŠKOVIĆ i M. BOŠKOVIĆ


Poljoprivredni fakultet, Institut za zaštitu bilja, Novi Sad

 

Dve hibridne linije pšenice sa tri para gena otpornosti prema Puccinia recondita tritici su modelirani prema sistemu gen-za-gen odnosa u konstantnim (definitivnim) i različitim (nedefinitivnim) spoljnim uslovima. U radu se diskutuje više različitih karakteristika sistema parazit : domaćin : spoljni uslovi. Primena modela gen-za-gen sa Boolcan-ovim algebarskim pristupom je pokazala znatne prednosti prema konvencionalnim metodama, pošto je najmanje povećanje parametara V ili N rezultiralo u širokim mogućnostima genetske diferencijacije izvora otpornosti. Definitivni genotipovi agrikorpusa, koji pokazuju male razlike u konstantnim spoljnim uslovima mogu da proizvedu mnogo šire razlike fenotipova ukoliko se ispoljavaju u drugim spoljnim uslovima. Iz ovoga proizilazi da je delimična funkcija defmitivnih genotipova agrikorpusa u ncdefinilivnim spoljnim uslovima najvcrovatnija osnova "horizontalne otpornosti" i "otpornosti sporijeg razvoja patogena rđa". U tom slučaju mnoge objavljene horizontalne otpornosti, su isto tako kontrolisane uzajamnim odnosima gen-za-gen u promenjivim spoljnim uslovima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PROUČAVANjE PROCESA MIKROGAMETOGENEZE IN VITRO KOD VIŠNjE

 

R. CEROVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za voćarstvo i vinogradarstvo Čačak, Čačak

 

Epifluorescentnim mikroskopom praćen je proces muške gametogeneze in vitro kod dve sorte višnje primenom fluorohroma specifičnih za DNK : ethidium bromide i hoeehst 33258. Oba fluorohroma omogućavaju jasnu vizuelnu diskriminaciju vegetativnog i generativnog jedra, odnosno spermatičnih jedara u polenovom zrnu t polenovoj cevčici, kada se koriste kao vitalne boje, kao i posle fiksacije. U pogledu bojene reakcije oba fluorohroma su bila superiornija kada su korišćena kao vitalne boje, dok je hoeehst 33258 davao i vizuelno bolju bojenu reakciju. Finalizacijom procesa gametogeneze u polenovoj cevčici nastaje dinamička funkcionalna struktura koja se sastoji iz vegetativnog jedra i dve spermatične ćelije poznata kao "male germ unit" - MGU. Kod obe sorte utvrđena je razlika u mobilnosti MGU u polenovoj cevčici što se neposredno dovodi u vezu sa različitom dinamikom isklijavanja i dužinom polenovih cevčica ispitivanih sorti. U oblasti reproduktivne biologije vodaka proces mikrogametogeneze in vitro, odnosno ponašanje i migracija jedara polena u toku rasta polenove cevčice predstavlja neophodan prerekvizit od čije regularnosti zavisi odvijanje procesa dvojne oplodnje.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KOMBINACIONE SPOSOBNOSTI ZA INDEKS LISNE POVRŠINE (LAI) KOD ŠEĆERNE REPE (Beta vulgaris L.)

 

N. ČAČIĆ, L. KOVAČEV i Snežana MEZEI

Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Univerzitet u Novom Sadu, Novi Sad

 

Cilj ovog rada bio je ispitivanja efekta gena i kombinacionih sposobnosti šest genotipova šećerne repe za svojstvo indeks lisne površine (LAI). Šest različitih genotipova šcćerne repe dialelno su ukršteni, a u ispitivanje su uključeni roditelji i f1 bez recipročnih ukrštanja. Visoko značajne vrednosti opštih (OKS) i posebnih kombinacionih sposobnosti (PKS), dobijene u ovim ispitivanjima, ukazuju da je u nasleđivanju ovog svojstva zastupljen i aditivni i neaditivni efekat gena (dominacija i epistaza). Odnos OKS/PKS ukazuje na veći uticaj aditivnog efekta gena na ukupnu genetičku varijabilnost indeksa lisne površine (LAI). Dva genotipa (A-0900 i B-200) imala su negativne vrednosti OKS za indeks lisne površine, dok su ostala četiri genotipa (CS-950, C-300, MS-504 i F-489) imala pozitivne vrednosti OKS za ovo svojstvo. Signifikantno pozitivne vrednosti PKS imalo je samo ukrštanje A-0900 x C-300, dok je još sedam ukrštanja imalo pozitivne vrednosti PKS za indeks lisne površine. Rezultati ovih ispitivanja su pokazali da su najbolje posebne kombinacione sposobnosti imala ukrštanja u kojima je jedan od roditelja sa negativnim a drugi sa pozitivnim vrednostima OKS za indeks lisne površine (LAI).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA EFEKTA GENA U NASLEĐIVANJU BROJA ZRNA PO KLASU PŠENICE

 

M. DIMITRIJEVIĆ, Sofija PETROVIĆ i Marija KRALJEVIĆ-BALALIĆ

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Novi Sad

 

Regresionom analizom varijanse i kovarijanse u dialelnom ukrštanju, je ispitivan efekat gena u nasleđivanju broja zrna po klasu pet genotipova pšenice (Triticum aestivum ssp. vulgare) i to: NS Rana 2, Bankut 1205, NS 732, Atlas 66 i Siete Cerros 66. Utvrđeno je odsustvo interalelne interakcije, što opravdava primenu odabranog modela. Regresiona analiza pokazuje dominantan efekat gena na ispitivano svojstvo, kao i nejednak raspored dominantnih i recesivnih gena između analizovanih sorata. Rezultati upućuju da veći broj dominantnih gena dovodi do povećanja broja zrna po klasu, dok povećan sadržaj recesivnih gena ima suprotan efekat.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

REKURENTNA SELEKCIJA NA FENOTIP KONZUMNOG TIPA SUNCOKRETA (Helianlhus annuus L. var. macrocarpus Ckll.)

 

B. DOZET, R. MARINKOVIĆ

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Nakon dva ciklusa rekurentne selekcije ispitivano je 8 sintetičkih populacija, a kao standard korišćen je hibrid NS-Delija. Dve sintetičke populacije imale su značajno veći udeo krupne frakcije (>4,5 mm), u odnosu na standard, a tri populacije značajno veći udeo krupne i srednje frakcije (>2,5 mm). Nijedna ispitivana populacija nije imala značajno veći udeo jezgra u odnosu na standard, a on je iznosio od 65,85% do 72,94%. Pet populacija su imale značajno veći sadržaj proteina, dok je kod sedam populacija utvrđen značajno niži sadržaj ulja od standarda. Utvrđena je jaka negativna korelacija (r=-0,57) između sadržaja proteina i sadržaja ulja. Dve populacije i hibrid NS-Delija su bile otporne na lisnu rđu. Broj zaraženih biljaka korenskom i stabljičnom formom bele truleži se kretao od 0,77% do 15,27%. Samo jedna populacija je imala značajno veću otpornost na ovo oboljenje, u odnosu na standard. Na osnovu ovih ispitivanja, dve stvorene sintetičke populacije pokazale su kumulaciju poželjnih osobina, pa se mogu u daljem radu koristiti za stvaranje inbred linija suncokreta konzumnog lipa.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA DOBIT OD SELEKCIJE NA BAZI HS POTOMSTAVA KOD DVE SINTETIČKE POPULACIJE KUKURUZA

 

G. DRINIĆ, M. IVANOVIĆ i Jelena VANČETOVIĆ

 

Institut za kukuruz "Zemun Polje", Beograd - Zemun

 

Na osnovu parametara dobijenih iz analize varijanse po Nested dizajnu - Random model izračunata je genetička dobit od selekcije (Spreque and Eberhart, 1977) primenom HS rekurentne selekcije kod četiri ispitivane top-cross kombinacije kukuruza (BS12C8C1 x L82, BS12C8C1 x LI5, ZPEP x L82 i ZPEP x L15). Ogledi su postavljeni u 1991. god. u Z. Polju, Inđiji i V. Plani po Nested dizajnu. Najveća vrednost genetičke dobiti za prinos zrna (t/ha) je izračunata za kombinaciju ZPEP x L82 (5,31%/ciklusa za intenzitet selekcije = 20%, odnosno 7,8% za intenzitet selekcije = 5%), a najniža za kombinaciju BS12C8C1 x L82 (4,47%/ciklusu za intenzitet selekcije = 20%, 6,59% za intenzitet selekcije = 5%). Izračunate vrednosti su nešto veće od očekivanih zbog toga šlo je procena genetičke dobiti izračunata na osnovu ukupne genetičke varijanse, a ne na osnovu aditivne varijanse. Rezultati ukazuju na mogućnost uspešne primene HS rekurentne selekcije kod ispitivanih kombinacija.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENOTIPSKE SPECIFIČNOSTI UTICAJA MASE, KONCENTRACIJE I KOLIČINA AZOTA U SEMENU NA VITALNOST PONIKA PŠENICE

I. AKUMULACIJA, RASPODELA I KONCENTRACIJA AZOTA U BILJCI

 

D. ĐOKIĆ, S. LOMOVIĆ, M. MILOVANOVIĆ i R. OGNjANOVIĆ

 

Institut za istraživanja u poljoprivredi "SRBIJA" – Beograd, Centar za strna žita, Kragujevac

 

U ogledu u sudovima sa kvarcnim peskom ispitivano je usvajanje azota iz semena u toku klijanja i nicanja i početnih faza rastenja biljaka u 24 sorte ozime pšenice. Za ova ispitivanja proizvedeno je seme od svake sorte sa dva nivoa koncentracije azota manjom 1,3-1,6 i većom 1,8-2,6%. Obe grupe semena podeljene su na sitniju <2,8 u sorata sa sitnijim i >3,0 mm u sorata sa krupnijim zrnom i krupniju frakciju iznad ovih vrednosti. Sejano je 50 zrna/sud. U fazi tri lista biljke su isprane od peska, podeljene na koren i nadzemni deo, sušene do vazdušno suvog stanja, merene i analizirane na sadržaj azota. Analizirani su akumulacija azota u biljci i iskorišćavanje azota biljke u formiranju suve materije biljke (fiziološka efikasnost azota). Akumulacija azota u biljci bila je veća u varijanata sa većom masom semena i većem koncentracijom azota. Zapažene su znatne razlike među sortama u količinama azota u biljci. Iskorišćavanje azota iz semena bilo je veće u varijantama sa sitnijim semenom i nizom koncentracijom azota. U ovim varijantama nađene su veće količine azota u biljci nego u semenu. Taj povećani sadržaj azota u biljci posledica je uzimanja azota iz vode ili je dobijen na račun azotofiksacije na korenu. U ovom pogledu izučavane sorte su se znatno razlikovale. Efikasnost iskorišćavanja azota biljke u stvaranju suve materije bila je veća u biljaka dobijenih iz sitnijeg semena i semena sa niskom akumulacijom azota. Ispoljile su se znatne razlike među sortama u visini ovog pokazatelja. Efikasnost azota u biljci bila je u negativnoj korelaciji sa akumulacijom. Sorte sa većom količinom i koncentracijom azota pozitivno su uticale na akumulaciju, a negativno na iskorišćavanje.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENOTIPSKE SPECIFIČNOSTI UTICAJA MASE, KONCENTRACIJE I KOLIČINA AZOTA U SEMENU NA VITALNOST PONIKA PŠENICE

II. EFIKASNOST MASE I AZOTA SEMENA

 

D. ĐOKIĆ, S. LOMOVIĆ, M. MILOVANOVIĆ i R. OGNJANOVIĆ

 

Institut za istraživanja u poljoprivredi "SRBIJA" – Beograd, Centar za strna žita, Kragujevac

 

U ogledu u sudovima sa kvarcnim peskom sa 24 sorte ozime pšenice izučavan je uticaj mase, koncentracije i sadržaja azota u zrnu na prinos suve materije u fazi tri lista. Za ova ispitivanja od svake sorte proizvedeno je seme sa nizim 1,3-1,6 i višim 1,9-2,7% azota. Obe grupe semena podeljene su na krupniju >2,8 mm za sorte sa sitnijim i 3,0 mm za sorte sa krupnijim semenom i sitniju frakciju ispod ovih vrednosti. Analizirani su efikasnost mase zrna - količina suve materije biljke po jedinici mase zrna i efikasnost azota zrna - količina suve materije biljke po jedinici azota biljke. Efikasnost azota zrna u proseku za sve četiri varijante kretale su se 48 do 63 mg suve materije na mg azota zrna. Najveće vrednosti konstatovane su u sorata Novosadska Rana 2, Logan i Francuska. Efikasnost azota zrna bila je znatno veća u biljaka dobijenih iz zrna sa manjim sadržajem azota. Između biljaka dobijenih od krupnije i sitnije frakcije semena iste koncentracije azota nije bilo bitnijih razlika u efikasnosti azota zrna. Efikasnost mase zrna je varirala u nešto manjoj meri. U proseku za sve varijante kretala se od 0,8 do 1,08. Najveće vrednosti nađene su u sorata Rumska crvenka, Logan, Nizija, Obrij i Super Zlatna. Ponici dobijeni od sitnijeg semena imali su veću efikasnost mase zrna. U ponovljenom ogledu pri dužem danu i većem intenzitetu svetlosti, u biljaka dobijenih iz semena sa većom koncentracijom azota dobijena je veća efikasnost mase i azota semena.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENOTIPSKE SPECIFIČNOSTI UTICAJA MASE, KONCENTRACIJE I KOLIČINA AZOTA U SEMENU NA VITALNOST PONIKA PŠENICE

III. USVAJANJE AZOTA ZRNA, NJEGOVA AKUMULACIJA I ISKORIŠĆAVANJE U BILJCI

 

D. ĐOKIĆ, S. LOMOVIĆ, M. MILOVANOVIĆ i R. OGNJANOVIĆ

Institut za istraživanje u poljoprivredi "SRBIJA" – Beograd, Centar za strna žita, Kragujevac

 

U ogled u u sudovima sa kvarcnim peskom ispitivan je uticaj krupnoće zrna i koncentracije azota u njemu na prinos i raspodelu suve materije i koncentraciju azota u ponicima 24 sorte pšenice. Korišćeno je seme dve frakcije krupnoće semena ispod i iznad 2,8 mm u sorata sa sitnijim i 3,0 mm u sorata sa krupnijim semenom i dve koncentracije azota koje su zavisno od sorte iznosile 1,31-1,66% i 1,81-2,58% N. Prinos suve materije nadzemnog dela i korena u proseku za sve četiri varijante kretao se od 1,66-2,09 g na 50 biljaka (sud). Najveći prinos suve materije dobijen je u sorata Rumska Crvenka, Skopljanka, Obrij, KG-56 i Logan. Prinos suve materije ponika u proseku za sve sorte pri istoj koncentraciji azota u semenu bio je veći u biljaka dobijenih iz sitnijeg semena.

Razlike u koncentraciji azota u semenu nisu imale uticaja na prinos suve materije. U ponovljenom ogledu pri dužem danu i većem intenzitetu svetlosti dobijen je veći prinos suve materije ponika poreklom iz krupnijeg semena i semena veće koncentracije azota. Koncentracija azota u ponicima u proseku za sve četiri varijante bila je veća u sorata sa većim sadržajem proteina u zrnu.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NEKI POKAZATELJI EFIKASNOSTI MINERALNE ISHRANE PŠENICE KAO SELEKCIONI KRITERIJUM


D. ĐOKIĆ, M. KOSTIĆ, S. LOMOVIĆ i M. JELIĆ

Institut za istraživanja u poljoprivredi "SRBIJA", Beograd, Centar za strna žita, Kragujevac

 

Dat je opis nekih parametara značajnih za izučavanje efikasnosti mineralne ishrane pšenice i njene primene u selekcionom radu. Efikasnost mineralne ishrane pšenice meri se količinom suve materije ili zrna no jedinici upotrebljenih ili pristupačnih hraniva u zemljištu. Efikasnost odnosno jačina uticaja mineralne ishrane na prinos ostvaruje se kroz usvajanje odnosno akumulaciju hraniva i njihovo iskorišćavanje u biljci i formiranju prinosa. Efikasnost akumulacije reprezentuje aktivnost korenovog sistema da usvaja mineralne materije, a efikasnost iskorišćavanja aktivnost nadzemnog dela da uključuje usvojena hraniva u sintetičke procese biljaka.

Akumulacija i iskorišćavanje hraniva u biljci su često u negativnoj korelaciji što usložnjava selekciju pšenice na povećanju efikasnosti đubrenja. Prinos kao proizvod ova dva parametra može biti rezultanta visoke vrednosti jednog i niskih vrednosti drugog ili osrednje vrednosti oba pokazatelja. Objedinjavanjem visoke vrednosti ova dva pokazatelja u novom genotipu moglo bi se dalje povećavati efikasnost đubrenja i produktivnost. Analizirani su i neki drugi parametri kao merilo efikasnosti mineralne ishrane pšenice kao što su koncentracija hraniva u biljci, žetveni indeks hraniva i razvijenost i aktivnost korenovog sistema. Preporučuje se da se efikasnost mineralne ishrane roditeljskih parova i njihovog hibridnog potomstva ispituje u uslovima nedovoljne, ali blizu optimalne obezbeđenosti odgovarajućim hranivom tj. u uslovima u kojima se nedostatak ispitivanog hraniva javlja kao glavni ograničavajući faktor rastenja i produktivnosti. U takvim uslovima genotip najbolje isopoljava svoju otpornost odnosno osetljivost na nedostatak hraniva

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFIKASNOST ISHRANE PŠENICE AZOTOM KAO GENOTIPSKA KARAKTERISTIKA

 

D. ĐOKIĆ, M. KOSTIĆ, S. LOMOVIĆ i M. MILOVANOVIĆ

 

Institut za istraživanje u poljoprivredi "SRBIJA", Beograd, Centar za strna žita, Kragujevac

 

U tri poljska i tri ogleda u sudovima sa zemljom (podlozi, aluvijum, smonica) izučavanje efikasnost ishrane azotom različitih sorata pšenice. Analizirana je efikasnost ishrane (đubrenja) azotom kao proizvod iz akumulacije i iskorišćavanje azota biljke u formiranju prinosa, sadržaja azota u zrnu i žetveni indeks azota, Akumulacija azota u nadzemnom delu biljke varirala je od 315-392 mg N/2,5 dm2 setvene površine. Najveće vrednosti dobijene su u sorata Florida, Bezostaja, Studenica i Francuska. Efikasnost iskorišćavanja azota biljke u formiranju prinosa u proseku za sve oglede iznosila je 39-48 g zrna na g/azota biljke. Najveće vrednosti dobijene su u sorata Francuska, Srbijanka, Florida i Dinastija. Akumulacija azota u biljci bila je veća u ogledima u sudovima, a iskorišćavanje azota biljke u poljskim ogledima. Efikasnost ishrane azotom iznosila je 13,1-18,8 g na 2,5 dm2 i bila je najveća u sorata Dinastija, Francuska, Florida, Srbijanka i Studenica. Rezultati pokazuju da se isti ili slični prinosi mogu dobili različitim vrednostima akumulacije i iskorišćavanja azota u biljci. Objedinjavanjem najvećih vrednosti ovih pokazatelja iz različitih sorata u novom genotipu moglo bi se dobiti da ne povećavamo prinos rodnijeg roditelja. Ukazuje se na probleme koje ima da izazove postojanje negativne korelacije između akumulacije i iskorišćavanja azota u biljci u selekciji pšenice na povećanu efikasnost ishrane azotom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NEKE FIZIOLOŠKE OSNOVE ZA GENOTIPSKO POBOLJŠANJE SADRŽAJA PROTEINA U ZRNU PŠENICE

 

D. ĐOKIĆ, M. KOSTIĆ, S. LOMOVIĆ i M. MILOVANOVIĆ

 

Institut za istraživanje u poljoprivredi "SRBIJA", Beograd, Centar za strna žita, Kragujevac

 

Zadatak ovih izučavanja bio je da se odrede neki važniji fiziološki pokazatelji koji utiču na genotipske razlike u sadržaju proteina u zrnu pšenice. Ispitivanja su izvedena u ogledu sa sudovima sa sortama pšenice sa povećanim (Tamiš, El Gaucho) i smanjenim sadržajem proteina u zrnu (Srbijanka i Skopljanka). Analizirani su pokazatelji akumulacije i raspodele suve materije i koncentracije, akumulacije, raspodele i iskorišćavanja azota u biljci. U fazi cvetanja nije bilo bitnih razlika u pogledu akumulacije i raspodele suve materije i azota u biljci između sorata sa većim i manjim sadržajem proteina. Biološki prinos bio je sličan, a prinos zrna i žetveni indeks zrna znatno manji u sorte El Gaucho, a u sorte Tamiš slični kao i u sorata sa manjim sadržajem proteina. Sorte sa povećanim proteinom odlikovale su se većim kapacitetom ukupnog i produktivnog bokorenja. Razlike u sadržaju azota u zrnu između sorata sa većim i manjim sadržajem proteina bile su bolje izražene pri nižem nivou ishrane azotom. Odnos koncentracije azota u zrnu i slami bio je povoljniji u korist zrna u sorata sa povećanim sadržajem proteina. Akumulacija azota u nadzemnom delu i njen prirast u reproduktivnom periodu bili su veći u sorte Tamiš, a slični u sorte El Gaucho kao i u sorata sa nižim sadržajem proteina. Žetveni indeks azota bio je sličan, a fiziološka efikasnost znatno niža u sorata sa povećanim sadržajem proteina. Akumulacija suve materije i azota u biljci po jedinici prinosa zrna bila je znatno veća u sorata sa povećanim sadržajem proteina. Povećanje sadržaja azota u zrnu u sorte Tamiš dobijeno je uglavnom kroz povećanje koncentracije i akumulacije azota u biljci, a u sorata El Gaucho na račun smanjenja prinosa zrna. Rezultati pokazuju da je povećana akumulacija azota u biljci bitan uslov za prevazilaženje u selekciji pšenice negativne korelacije između prinosa i sadržaja proteina u zrnu i stvaranje osnove za povećanje sadržaja proteina uz zadržavanje visoke produktivnosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

FENOTIPSKE KORELACIJE ZA OTPORNOST STABLA PREMA POLEGANJU KOD (B14 x K134)F2 SINTETIČKE POPULACIJE KUKURUZA (Zea Mays L.)

 

J. ĐORĐEVIĆ i M. IVANOVIĆ

 

Institut za kukuruz, "Zemun Polje", Beograd - Zemun

 

Za proučavanje su korišćena S1 potomstva (B14 x K134)F2 sintetičke populacije kukuruza. Višestrukom korelacionom analizom utvrđen je nivo fenotipskih korelacija između prinosa zrna i otpornosti stabla prema poleganju s jedne strane i devet osobina stabla s druge strane. Sadržaj vode i udeo mehaničke kore u stablu najviše utiču na procenat poleglih biljaka, kao pokazatelj opšte otpornosti stabla prema poleganju. Nije ustanovljena signifikantna fenotipska korelacija između procenta poleglih biljaka i prinosa zrna. To znači da selekcija na povećanu otpornost stabla prema poleganju neće limitirati budući progres u povećanju genetičkog potencijala rodnosti zrna kukuruza.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ "afila" GENA NA FORMIRANJE MAHUNA GRAŠKA Pisum sativum L.

 

R. ĐORĐEVIĆ 1, Z. MARKOVIĆ 1, V. PEŠIĆ 2 i I. ĐINOVIĆ 3

 

1 Institut za istraživanja u poljoprivredi "Srbija", Beograd, Centar za povrtarstvo, Smederevska Palanka

2 Poljoprivredni fakultet, Beograd - Zemun
3 Visa poljoprivredna škola, Prokuplje

 

Gen af u recesivnom homozigotnom stanju kod graška uslovljava modifikaciju biljaka, tako da one umesto listova normalne grade formiraju samo vitice sa zaliscima. Sorta Filigreen "afila" tipa ukrštana je sa 12 sorata normalne grade lista sa ciljem ispitivanja uticaja afila genotipa na formiranje mahuna. Genetska analiza F1 i F2 generacije (odnos razdvajanja 3:1 normalan list : afila) potvrdila je monogenetski recesivni karakter ove osobine. Broj mahuna po biljci u F1 generaciji (koja je normalnog lista) bio je već nego kod roditelja oba tipa. U F2 generaciji afila genotipovi su imali 13% mahuna po biljci manje nego F1 generacija, a u odnosu na roditelje za 1% manje od roditelja normalnog lista, odnosno oko 30% više od afila roditelja. Smanjenje broja mahuna po biljci u F2 generaciji kod afila genotipa uslovljen je smanjenjem asimilacione površine.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETSKA SPECIFIČNOST MORFOLOŠKIH SVOJSTAVA HALF-SIB POTOMSTVA HIBRIDNOG PLATANA

 

Matilda ĐUKIĆ i Dragica OBRATOV

 

Šumarski fakultet, Beograd

 

Proučavanje morfološke varijabilnosti Platanus x. a cerifolia Ait./Willd. putem analize half-sib potomstva 45 matičnih stabla sa područja Beograda, ima za cilj da omogući šire korišćenje ove vrste i našim uslovima. Osnovu za to pružaju svojstva kao što su brzi rast, dugovečnost, otpornost na nepovljone faktore sredine, dekorativnost itd. Analiza morfoloških parametara potomstva (visina, prečnik i masa sadnica, dimenzije, masa i specifična površina listova), pokazuje prisustvo veoma izraženog varijabiliteta kako između pojedinih familija tako i unutar svake familije. S obzirom da je potomstvo odgajeno u manje - više homogenim ekološkim uslovima (što pokazuje i analiza varijanse), varijabilnost analiziranih svojstava je rezultat genetske specifičnosti. Na osnovu dobijenih podataka izdvojene su individue sa odgovarajućim svojstvima kao što su brz ili spori rast, izraziti debljinski prirast, formiranje moćnog korenovog sistema, listova sa velikom asimilacionom površinom ili izraženim mezofilom i dr. Najznačajnija su stabla koja istovremeno poseduju veći broj privredno značajnih svojstava. Korišćenje proučenih morfoloških kriterijuma mozc ubrzati i unaprediti postupke pri izboru semenskih stabala i oplemenjivanju javorolisnog platana za potrebe proizvodnje sadnica u oblasti šumarstva i pejzažne arhitekture. Sprovedena istraživanja ukazuju na veliki genetski potencijal i adaptibilnost hibridnog platana, što potvrđuju i dobra fenotipska svojstva odabranih matičnih stabala kao i vitalnost i bujnost njihovog potomstva.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFIKASNOST UNUTAR LINIJSKE I RECIPROČNO POVRATNE SELEKCIJE PRI  UNAPREĐENjU TELESNE MASE I PLODNOSTI  MIŠEVA

 

Ž. GAJIĆ i A.E. BELL

Poljoprivredni fakultet, Beograd - Zemun
Purdue University, Lafayette, Indiana, USA

 

Osnovni cilj primene selekcije jeste sistematsko genetičko poboljšanje najvažnijih svojstava postojećih životinjskih i biljnih vrsta. Danas postoji veći broj metoda za poboljšanje populacija, kao što su selekcija unutar čistih linija koja se zasniva na korišćenju aditivne genetičke varijanse i povratna i recipročno povratna selekcija koje koriste pored aditivne i neaditivnu genetičku varijansu. S ciljem unapređenja telesne mase 60. dana uzrasta miševa izvedena su uporedna ispitivanja efikasnosti selekcije unutar linija na osnovu sopstvene vrednosti i recipročno povratne selekcije na osnovu vrednosti dobijenih meleza. Za ispitivanje su kao polazne poslužile dve linije miševa (Goodale Large While i Falconer N.F. linija) u toku 9 generacija selekcije. Ocena genetskih promena po generaciji izvršena je pomoću linearne (b) i kvadratne regresije (y), koja pokazuje da li genetski napredak po generaciji se povećava ili opada. Dobijeni rezultati pokazuju da je prosecan genetski napredak po generaciji u telesnoj masi 60. dana iznosio kod selekcije unutar linija (0,270 ± 0,072), a nešto manji kod recipročno povratne selekcije (0,249 ± 0,107). Istraživanja su pokazala da se efikasnost, posle 9 generacija, direktne selekcije na povećanje telesne mase miševa 60. dana uzrasta nije razlikovala kod unutar linijske i recipročno povratne selekcije. Za uspešnu selekciju je značajno kakva je zavisnost između osobina, jer se na osnovu toga može zaključiti kakve se promene mogu očekivati kod drugih osobina koje su u zavisnosti sa osobinom koja je obuhvaćena selekcijom, tj. korelativni selekcijski napredak. Stepen korelatiovnog selekcijskog reagovanja je utvrđen metodom regresije odstupanja od kontrole na broj generacije. Regresijski koeficijenti iznose kod ukupnog broja mladunaca 0,105 ± 0,054, broja živorođenih 0,132 ± 0,050 i broja odlučenih 0,132 ± 0,055 pri unutar linijskoj selekciji, odnosno kod ukupnog broja 0,125 ± 0,072, broja živorođenih 0,158± 0,073 i broja zalučenih 0,129 ± 0,053 pri recipročno povratnoj selekciji. Nešto veće vrednosti su dobijene kod telesne mase pri odbijanju (0,168 ± 0,096 odn. 0,156 ± 0,080), a najveće kod telesne mase 42. dana (0,310 ± 0,081 odn. 0,254 ± 0,057) kod unutar linijske odnosno recipročno povratne selekcije. Prosečni koeficijent regresije kod telesne mase pri odbijanju su značajne, dok su kod mase tela 42. dana vrlo značajne. Prosečni regresioni koeficijenti bili su pozitivni kod svih osobina i slični kod oba metoda selekcije. Iz uporednih ispitivanja efikasnosti unutar linijske i recipročno povratne selekcije pri unapređenju telesne mase i plodnosti miševa moze se zaključiti da između navedenih metoda nema značajnih razlika.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

OSOBINE RASTA OŽILJENICA SIBIRSKOG BRESTA (Ulmus pumila L.) SA PATULJASTIH MATIČNIH BILJAKA

 

M. GRBIĆ

 

Šumarski fakultet, Beograd

 

Iz slobodnooprašenog semena sa jedne individue sibirskog bresta izdvojen je klijavac sa tipičnim "jacubuša" osobinama. Posle prve vegetacije visina nadzemnog dela bila je 5 cm, a listovi oko 1 cm. Iz istog half sib potomstva izdvojena je individua čiji je nadzemni deo na kraju prve vegetacije bio 54 cm dug, što je bilo iznad proseka ove familije. Osobine rasta ove individue nisu ukazivale na predispoziciju ka nanizmu. Narednih pet godina prva, patuljasta, individua gajena je u prostranoj posudi čiji zidovi nisu ometali razvoj korena. Druga individua je presađena u plitku posudu i orezivana standardnom bonsai tehnikom. Posle pet godina habitus druge individue bio je veoma sličan prvoj. Sa obe individue je lada uzeto po deset korenskih i deset zelenih reznica. Oživljavanje je izvršeno po ustaljenoj proceduri, a komparativna merenja izvršena su na kraju prve vegetacije. Rezultati ogleda potvrđuju polaznu pretpostavku, da je kod prve individue poreklo nanizma u naslednim činiocima, jer je porast nadzemnog dela njenih oželjenica značajno manji od porasta ožiljenica druge individue. Metoda vegetativnog razmnožavanja kod individue kod koje je patuljast rast indukovan uticajem spoljašnjih faktora utiče na brzinu prelaska osobina na ishodni oblik pri izmeni uslova pod kojima je došlo do pojave nanizma. Do pojave jacubuša osobina u praksi može doći pod uticajem genetskih, ali isto tako i uticajem spoljašnjih faktora, pod uslovom da je norma reakcije individue dovoljno široka da intenzivno orezivanje nadzemnog dela i korena ne bude letalno za nju.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RAZLIKE IZMEĐU ŠEST SORTI BELOG DUDA (Morus alba, L.) RAZMNOŽAVANIH IN VITRO


Branislava GRBOVIĆ i Biljana NIKOLIĆ

Institut za šumarstvo, Beograd

 

Za osnivanje primarne kulture korišćeni su aksilarni pupoljei jednogodišnjih sadnica 6 sorti: Kurimelto I1N2, Murasaki-Vase I1N2, Ošima I1N2, Taškent-Saniš" 15, No-106 i Kumrin. Hranljiva podloga za razvoj kulture je MS-medijum (Murashiga and Skoog, 1962) uz dodatak hormona BAP i 1BA. Merena svojstva su broj novih eksplantata, dužina glavnog izdanka, dužina glavnog korena i broj korenovih žila I reda. Putem t-testa u ogledima mulliplikacije sa različitim koncentracijama BAP-a (0,0 - 2,0 mgl-1 ) utvrđene su signifikantne razlike između japanske sorte Murasaki-Vase I1N2 i bugarske sorte Kumrin. U ogledima oživljavanja sa 0,5 mgl -i IBA kod svih sorti došlo je do razvoja korenova i utvrđene su značajne razlike. Ispitivanje interakcije sorta - koncentracija IBA (0,0 - 1,5 mgl-1) u ogledima sa dodatkom aktivnog uglja (0,1%) vršeno je putem analize varijanse. Vrednosti F-testa su pokazale da je interakcija značajna samo za osobine korena dok su razlike između sorti signifikantne za sva merena svojstva eksplantata.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KOMPONENTE GENETIČKE VARIJANSE ZA DUŽINU I ŠIRINU PLODA HIBRIDA PAPRIKE (Capsicum annuum L.)

 

Đ. GVOZDENOVIĆ, Marija KRALJEVIĆ-BALALIĆ, I. MIHALJEV i A. TAKAČ

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Novi Sad

 

Paprika je jedna od najznačajnijih povrtarskih vrsta. Kod nas se gaji na oko 25.000 ha, a koristi se za ishranu bilo u svežem, konzervnom, prerađenom ili zamrznutom stanju. Hranljivu vrednost ploda paprike čine sadržaj šećera, belančevina, vitamina, a posebno C vitamina, mineralnih materija, zatim masti i aromatičnih materija. Heterozis za prinos kod paprike ustanovljen je u mnogim istraživanjima, međutim, širenje hibrida u proizvodnoj praksi ometa skupa proizvodnja hibridnog semena. Cilj ovog rada bio je da se ispilaju genetičke varijanse, aditivna i dominantna kao i opšte i posebne kombinirajuće sposobnosti, za dužinu i širinu ploda hibrida paprike. Za ovu svrhu odabrano je sedam roditelja kao majke (sorte ili linije) (L-1/2, Viktorija, Feherozon sinteticus, Albaregija, Hebar, Corno Di Toro Rosso i Buketna 1) i tri roditelja kao očevi (testeri) (Kalifornijsko čudo, šorokšari i Matica). Ogledi su izvedeni po standardnoj metodici na oglednom polju Instituta za ratarstvo i povrtarstvo na Rimskim Šančevima. Na osnovu dobijenih rezultata može se konstatovali da je neaditivna komponenta za dužinu ploda bila veća od aditivne, ali i aditivna je takođe bila značajna, dok je za širinu ploda veći uticaj imala aditivna komponenta genetičke varijanse. Najbolji opšti kombinator za dužinu ploda bila je sorta Corno Di Toro Rosso, a za širinu ploda linije L-1/2, koje su imale i najveće srednje vrednosti za ispitivana svojstva. Najveće vrednosti posebnih kombinirajućih sposobnosti za dužinu ploda imale su kombinacije Hebar x Kalifornijsko čudo i Buketna 1 x Matica, dok za širinu ploda ukrštanje između Albaregije i Kalifornijskog čuda. Na osnovu svega iznetog možemo zaključiti da su se ispitivani genotipovi signifikantno međusobno razlikovali za ispitivana svojstva.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PROCENA POGODNOSTI KORIŠĆENJA NEKIH KARAKTERISTIKA LISTA CRNIH TOPOLA (selekcija Aigeiros) ZA IDENTIFIKACIJU SORTI

 

V. GUZINA, S. ORLOVIĆ i G. ABRAMOVIĆ

 

Naučni institut za topolarstvo, Novi Sad

 

Registracija novih sorti topola na nacionalnom i internacionalnom nivou zahteva pouzdane kriterije za njihovu identifikaciju. U Zborniku (Proceedings) sa poslednjeg zasedanja Međunarodne komisije za topolu (I.P.C.) održanog u Saragosi (cd. Padro, 1992) dat je registar priznatih klonova u zemljama Članicama IPC, u koji su uključeni i naši klonovi i uz to su date i preporuke u pogledu fenotipskih karakteristika sadnica i stabala pogodnih za identifikaciju sorti. Te preporuke su velikim delom u skladu sa propisima OECDE-a i UPOV-a. Međutim, i pored toga još uvek nedostaju dovoljno pouzdani eksperimentalni podaci o stepenu genetske kontrole svojstava koja se najčešće koriste za identifikaciju genotipova pa su u tome pogledu neophodna dalja proučavanja. Ovaj rad predstavlja pokušaj da se na osnovu podataka merenja i opažanja list ova jedno- i dvogodišnjih sadnica topola dobiju informacije o intra- i inter-klonalnoj varijabilnosti više svojstava, među kojima bi se odabrala ona svojstva koja su najpogodnija za identifikaciju klonova, odnosno sorti. Od morfoloških parametara korišćene su dimenzije liske (dužina, širina, položaj mesta sa najvećom širinom, dužina glavnog nerva") zatim broj bočnih nerava, ugao između dva donja nerva i dužine peteljke, kao i koeficijenti međusobnih odnosa pojedinih veličina. Kod elementi anatomske građe korišćen je broj i veličina stoma i varijabilnost elemenata poprečnog preseka liske. Kao biohemisjki parametri korišćene su fenotipske slike izoenzima, a kao ostali, stepen osetljivosti na rđu (Melampsora sp.) i smeđu pegavost lišća (Marssonina brunnea). Sumarno uzevši kao najpouzdaniji parametri pokazali su se fenotipski izrazi varijabilnosti izoenzima, koeficijenti međusobnih odnosa pojedinih veličina dimenzija listova i stepen osetljivosti na lisna oboljenja. Međutim, treba imati u vidu da stepen napada oboljenja varira od godine do godine i da su moguće promene osetljivosti genotipova tokom vremena nastankom novih sojeva patogena, pa su u tome pogledu neophodna kontinuirana proučavanja međusobnih odnosa sorti i patogena.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

DOSTIGNUĆA U OPLEMENJIVANJU CRNOG BORA (Pinus nigra Am.) U SRBIJI

 

V. ISAJEV, A. TUCOVIĆ i Mirjana ŠIJAČIĆ

Šumarski fakultet, Beograd

 

Crni bor ima diskontinuirani areal, njegove izolovane populacije se odlikuju specifičnim genofondom i spontanom pojavom većeg broja unutarvrsnih taksona. Varijabilnsot i taksonomska pripadnost crnog bora u Srbiji manje je izučena i ako se njegove čiste ili mešovite populacije, kao i kulture uspešno razvijaju na različitim staništima. Primenom masovne i individualne selekcije intenziviran je rad na oplemenjivanju crnog bora u Srbiji detaljnim upoznavanjem: a) prirode karaktera varijabilnosti (diskontinuirana, kontinuirana), b) odnosa juvenilno adultnog stadijuma za neka važna fiziološka svojstva i c) semenskih izvora čije seme najbolje odgovara za određena staništa. Analizom grupne i individualne fenotipske promenljivosti, stacionarnim osmatranjima i analizom semena iz slobodnog oprašivanja izdvojeno je više populacija u Zapadnoj Srbiji i 40 test stabala od čijeg semena su proizvedene half sib familije. Dobijeni rezultati uporedno morfološko-fizioloških ispitivanja na nivou populacija, individua, semena i polusrodnika potvrdili su prisustvo znatne individualne i grupne promenljivosti. Ispitivanjem otpornosti polusrodnika na vodni stres identifikovani su fiziološki parametri značajni za proizvodnju sadnog materijala sa uvećanom otpornošću na stres presadnje. Na površini od 3 ha, od 6500 half sib sadnica iz 40 familija osnovana je semenska plantaža metapopulacione strukture koju čine šest ponovljenih srodnih struktura, čime se obezbeđuje bolje očuvanje genofonda u njima, dinamičnost razmene gena i životna vitalnost plantaže i semena.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

REKURENTNA SELEKCIJA SOJE: MEĐUZAVISNOSTI HERITABILNOST SADRŽAJA PROTEINA I KOMPONENTI PRINOSA U "PRO" POPULACIJI SOJE

 

Đ. JOCKOVIĆ 1, J.R. VILCOX 2, H.J. XU 2, Milica HRUSTIĆ 1 i M. STOJAKOVIĆ 1

 

1 Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Novi Sad

2 Purdue University, Department of Agronomy, W. Lafayette, Indiana, USA

 

Cilj istraživanja bio je da se ispitaju međuzavisnosti sadržaja proteina u zrnu, komponenti prinosa i prinosa zrna po biljci u "PRO" populaciji rekurentne selekcije soje. Nadalje, cilj istraživanja bio je da se ustanovi nivo varijabilnosti i heritabilnost ispitivanih svojstava nakon trećeg ciklusa rekurentne selekcije soje. Materijal za ova istraživanja dobijen je od Prof. J.R. Wilcox, Purdue univerzitet, W. Lafayette, Indiana, USA. Primenjena je metoda Brim-a i Burton-a (1981). Urađena su tri ciklusa rekukrentne selekcije. Kao vektori polena korišćene su pčele. Korelacija ispitivanih svojstava u "PRO" populaciji i populaciji 20% odabranih biljaka bile su podudarne. Između sadržaja proteina i ulja u zrnu u obe populacije ustanovljene su signifikantne negativne korelacije. Sadržaj proteina u zrnu i prinos zrna po biljci bili su u negativnoj korelaciji, izuzev u COSO i C1SO u "PRO" populaciji. U obe ispitivane populacije u C3SO ustanovljene su visokosignifikantne pozitivne korelacije između broja mahuna po biljci, mase 10100 zrna i visine biljke i prinosa zrna po biljci. Genotipovi sa većim brojem zrna no mahuni najčešće su imali nizi sadržaj proteina u zrnu u obe ispitivane populacije. Posle tri ciklusa rekurentne selekcije nije smanjena varijabilnost ispitivanih svojstava. Najviša heritabilnost (prcko 0.8%) ustanovljena je za dužinu vegetacije. Dobijeni rezultati ukazuju da u "PRO" populaciji soje egzistira dovoljna varijabilnost ispitivanih svojstava i da treba nastaviti rekurentnu selekciju.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KOMBINACIONE SPOSOBNOSTI ZA KOMPONENTE PRINOSA F1 HIBRIDA SUNCOKRETA (Helianthus annuus L.)


J. JOKSIMOVIĆ, R. MARINKOVIĆ i M. MIHALJČEVIĆ

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Cilj ispitivanja osnovnih kvantitativno-genetičkih parametara za komponente prinosa F1 hibrida suncokreta je procena kombinacionih sposobnosti inbred linija i F1 hibrida kao i međuzavisnost ispitivanih svojstava. Eksperimentalni materijal, selekcionisan u Institutu za ratarstvo i povrtarstvo, Novi Sad, obuhvatao je osam genetički divergentnih inbred linija i petnaest F1 hibrida. U obe godine istraživanja analizirana su sledeća svojstava: prinos semena, broj semenki i masa 1.000 semenki. Analizom kombinacionih sposobnosti metodom linija x tester (Singh i Choudhary, 1976) dobila se informacija o opštim kombinacionim sposobnostima (OKS) inbred linija, posebnim kombinacionim sposobnostima (PKS) F1 hibrida, komponentama genetičke varijanse, prosečnom doprinosu (%) linija, testera i njihove interakcije u ekspresiji dotičnog svojstva. Između ispitivanih genotipova suncokreta ustanovljene su značajne razlike u srednjim vrednostima za sva analizirana svojstva. U nasleđivanju prinosa semena i broja semenki po biljci, manifestovao se samo heterozis. Glavnu ulogu u nasleđivanju ima neaditivna komponenta genetičke varijanse. Definisane su inbred linije sa pozitivnim odnosno negativnim efektom OKS za ispitivana svojstva. Samo mali broj F1 hibrida suncokreta imao je značajne vrednosti PKS. Korelaciona analiza nam je omogućila sagledavanje međuzavisnosti ispitivanih svojstava. Ako se srednje fenotipske vrednosti, model F1 hibrida u odnosu na prinos semena, dobre OKS inbred linija i PKS F1 hibrida, kao i njihova stabilnost uzmu kao osnovna merila, linije HA-BCPL i RHA-178 predstavljaju najbolje roditeljske komponente.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ RAZLIČITE GERMPLAZME NA NASLEĐIVANjE OSOBINA PLODOVA HIBRIDA PAPRIKE F1 GENERACIJE

 

B. JOVANOVIĆ 1, S. PRODANOVIĆ l i D. STEVANOVIĆ 2

 

1 Poljoprivredni fakultet, Beograd - Zemun
2 Centar za povrtarstvo, Smederevska Palanka

 

Objekt istraživanja u ovom radu bile su četiri roditeljske sorte poreklom iz dve podvrste paprike: Capsicum annuum ssp. macrocarpum (sa varijetetima grossum i longum) i Capsicum annuum ssp. microcarpum (sa varijetetima acuminatum i longum). Na osnovu vrednosti pet osobina dialelnih F1 hibrida ispitano je ispoljavanje alela prema načinu delovanja kod roditeljskih varijeteta primenom VrWr regresione analize (Mather and Jinks, 1971). To je prva primena ovog metoda u našoj zemlji za ocenu genetičke divergentnosti germplazme paprike. Ustanovljeno je da se sve proučavane osobine ploda nasleđuju parcijalnom dominacijom. Pri tome varijeteti paprike sa krupnim plodovima imaju pretežno dominantne alele za broj plodova po biljci. Za širinu ploda dominantne alele nose pre svega varijeteti podvrste microcarpum. Izvor dominantnih gena za dužinu ploda je ssp. microcarpum var. longum. U nasleđivanju debljine perikarpa kod var. grossum su najbrojniji recesivni aleli, dok ostali varijeteti imaju pretežno dominantne gene. Za težinu ploda paprike dominantne gene uglavnom sadrže varijeteti ssp. microcarpum. Ovakav odnos gena za proučavane osobine kod roditelja ukazuje na izuzetnu složenost selekcije paprike. Zapravo u F1 generaciji parcijalno dominiraju roditelji sa manjim brojem plodova, sa uzim i kraćim plodovima tanjeg perikarpa, kao i roditelji sa lakšim plodovima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IDENTIFIKACIJA SORTI PREMA KOMPOZICIJI Gli- ALELA

 

D. KNEŽEVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita "Kragujevac", Kragujevac

 

Metodom PAG elektroforeze analizirana je kompozicija glijadinskih alela od 10 ozimih sorti pšenice stvorenih u Institutu za strna žita. Određena je genetička formula glijadinskih alela na osnovu identifikovanih blokova glijadina koji su kodirani genima lociranim na kratkim kracima 1A, IB, ID, 6A, 6B i 6D hromozoma. Identifikovano je 17 različitih alcla sa šest Gli- lokusa. Determinisan je različit broj alela na svakom lokusu i to: 3 alela na Gli-Al, Gli-Bl, Gli-Dl and Gli-D2,4 na GH-A2 i 1 na GH-B2 lokusu. Genetička formula kompozicije glijadinskih alela bila je karakteristična za svaku sortu. Aleli su označeni prema nomenklaturi Metakovsky, (1991). Učeetalost alela kod analiziranih sorti je imala veliki raspon variranja. Medu determinisanim Gli- alelima najveća učestalost je ustanovljena za alele: Gli-Alb, Gli-Blb, Gli-Dlb, Gli-A2b, Gli-B2b i Gli-D2b.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOST ALELA GLD LOKUSA KOD JUGOSLOVENSKIH SORTI OZIME PŠENICE (Triticum aestivum L.)

 

D. KNEŽEVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Beograd, Centar za strna žita "Kragujevac", Kragujevac

 

Analizirana je 91 sorta pšenice, stvorenih u selekcionim centrima (Novi Sad, Zagreb, Osijek, Kragujevac, Skopje, Vinkovci i Zemun), metodom acid PAGE (Novoseljskaia i sar., 1983). Kompozicija glijadina za sorte pšenice je određena na osnovu identifikacije glijadinskih blokova na elektgroforegramu. Determinisano je ukupno 47 alela sa Scsi GLD lokusa po metodu Metakovsky i sar. (1984). Na svakom lokusu ja determinisan različit broj alela i to: po 6 sa GLD 1A i GLD ID, 7 sa GLD IB, 8 sa GLD 6D, 9 sa GLD 6A i 11 sa GLD 6B. Identifikovani aleli su za izradu kataloga alela GLD lokusa, koji su predstavljeni shematskim prikazom blokova komponenti glijadina. Aleli se razlikuju prema broju, molekulskoj masi i aminoikiselinskom sastavu komponenti koje se nalaze u sastavu bloka. Učestalost alela je varirala između 1 i 49.5%. Najučestaliji aleli su bili GLD 1A4 (38.5%), GLD 1B1 (42,9%), GLD 1D1 (49,5%), GLD 6A2 (40,6%), GLD 6B1 (41,8), GLD 6D1 (41,8%).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIRANJE ALELA NA Gli LOKUSIMA KOD NEKIH MAKEDONSKIH SORTI PŠENICE

 

D. KNEŽEVIĆ 1, Mirjana MENKOVSKA 2 i Dragica ZORIĆ 2

 

1 Institut za istraživanja u poljoprivredi "Srbija", centar za strna žita "Kragujevac", Kragujevac

2 Žito Skopje, Skopje, Makedonija
3 Poljoprivredni fakultet, Beograd - Zemun

 

Podjedinice glijadina su ekstrahovane iz pojedinačnih zrna od 8 makedonskih sorti ozime pšenice i razdvojene pomoću PAG elektroforeze. Identifikovani su glijadinski aleli i ustanovljena učestalost alela. Glijadinski aleli su determinisani na osnovu identifikovanih blokova glijadinskih komponenti koji su kodirani genima lociranim na 1. i 6. grupi homologih hromozoma. Identifikovano je devetnaest alela sa šest Gli lokusa i to: tri alela na Gli-Al lokusu, tri na Gli-Bl, dva na Glil-Dl, tri na GH-A2, pet GH-B2 i tri na Gli-D2. Najveća učestalost alela je ustanovljena za Gli-Alb (62.5%), Gli-Bl 1 (37,5%), Gli-Dlb (62,5%), and Gli-D2b (62.5%).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA ANALIZA POVRŠINE LISTA ZASTAVIČARA KOD PŠENICE (Triticum aestivum L.)

 

D. KNEŽEVIĆ, M. PAVLOVIĆ, Marija KRALJEVIĆ-BALALIĆ l i Veselinka ZEČEVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita "Kragujevac", Kragujevac

1 Poljoprivredni fakultet Novi Sad, Novi Sad

 

U dialelnom ukrštanju (bez recipročnih) četiri genetički različite sorte pšenice (Jugoslavija, Žitnica, Novosadska Rana 2 i Osiječanka) proučavan je način nasleđivanja, način delovanja gena i raspored dominantnih i recesivnih gena kod F1, F2 hibrida i roditeljskih sorti pšenice za površinu lista zastavičara. Analiza komponenti genetičke varijanse je urađena po metodu Hayman (1954), Jinks(1954), a regresiona analiza po metodu Mather and Jinks (1971). Dobijeni rezultati pokazuju da je način nasleđivanja površine lista zastavičara kod pšenice različit. U F1 generaciji se ispoljava superdominacija uz pojavu heterozisa, a u F2 intermedijarno, parcijalna dominacija i superdominacija. Uzevši u obzir sve kombinacije u F1 i F2 generaciji, aditivna komponenta (D) je znatno manja od dominantne H1 i H2 što ukazuje da glavni deo genetičke varijanse u nasleđivanju ovog svojstva pripada dominantnoj komponenti. Na osnovu vrednosti F, (Kd/Kr), H2/4H1 ustanovljeno je da u ekspresiji ovog svojstva preovlađuju dominantni nad recesivnim alelima. Sa ovim je u saglasnosti izračunata veća učestalost dominantnih alela (u) u odnosu na recesivne (v). Prosečni stepen dominacije  ukazuje da se u nasleđivanju površine lista zastavičara u F1 radi o superdominaciji a u F2 o parcijalnoj dominaciji uzevši u obzir sve kombinacije ukrštanja. Sa ovim je u saglasnosti dobijen presek linije regresije sa Wr osom, koji se nalazi ispod koordinatnog početka u F1, a iznad koordinatnog početka u F2. Linija regresije je znatno udaljena od limitirajuće parabole što pokazuje da je genski sistem za nasleđivanje površine lista zastavičara po tipu dominacije sa malo aditivnosti. Raspored tačaka dijagrama rasturanja duž očekivane linije regresije je potvrdio genetičku divergentnost roditelja. Ustanovljeno je da je za površinu lista zastavičara od sorte Jugoslavija veći broj dominantnih u odnosu na recesivne gene a kod sorte Novosadska Rana 2 veći broj recesivnih gena u odnosu na dominantne.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLIMORFNOST Gli-D1 IGH-D2 LOKUSA PŠENICE (Triticum aestivum L.)

 

D. KNEŽEVIĆ, Ljiljana VAPA l i Aleksandra YURIEVNA NOVOSELSKAYA 2

Inslitut za istraživanja u poljoprivredi "Srbija", Centar za strna žita, Kragujevac, Kragujevac

1 Prirodno matematički fakultet, Novi Sad
2 Institut za opštu genetiku i molekularnu biologiju, Moskva

 

Geni odgovorni za sintezu proteina pšenice nalaze se na kratkim kracima hromozoma prve i šeste grupe genoma ABD. Dosadašnjim proučavanjima otkrivena je velika alelna varijabilnost svih šest glijadilnih lokusa. Neki aleli mogu poslužiti kao markeri nekih agronomski i tehnološki važnih osobina pšenice. U ovom radu prikazana je alelna varijabilnost glijadina kontrolisanih sa lokusa Gli-D1 i GH-D2 kod 61 sorte pšenice. Glijadini su ekstrahovani u 70% etanolu i razdvajani na 8,3% polikarilamid gelu pri pH 3,1. blokovi glijadina identifikovani su upoređenjem elektroforegrama analiziranih sorti sa sortama standardima. Genetička analiza je pokazala da glijadinski blokovi kontrolisani alelima Gli-Dl i GH-D2 sadrže 3-6 komponenti glijadina. Kod ispitivanih sorti identifikovano je pet različitih glijadinskih blokova kodiranih sa Gli-Dl, i sedam sa GH-D2 lokusa. Među najučestalijim alelima bili su Gli-Dlb i Gli-D2b.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MILA - NOVI KULTIVAR VINOVE LOZE ZA BELA VINA

 

Nada KORAĆ i P. CINDRIĆ

 

Institut za vinogradarstvo, voćarstvo i hortikulturu, Poljoprivredni fakultet, Univerzitet u Novom Sadu, Novi Sad

 

U uslovima kontinentalne klime rentabilnost gajenja postojećih kultivara za aromatična bela vina je ograničena zbog njihove slabe rodnosti (Traminac, Muskat Otonel) ili osetljivosti na niske zimske temperature (Neoplanta). Kao cilj oplemenjivačkog rada definisano je stvaranje novih kultivara ovog tipa, koji ce u odnosu na do sada gajenje biti rodniji, otporniji na niske zimske temperature i tolerantniji na gljivične bolesti. Primenjen je metod interspecies hibridizacije. Kao rezultat ukrštanja Kunleany x Muskat Olonel, nastao je kultivar MILA koji je priznat 1991. godine. Autori su P. Cindrić i N. Korać. Na osnovu dvanaestogodišnjih ispitivanja utvrđeno je da MILA, u odnosu na kontrolni kultivar Traminac crveni, ispoljava sledeća svojstva: sličnu, ali mnogo stabilniju rodnost i sadržaj šećera u širi; značajno veći sadržaj kiselina u širi; veću otpornost na Botrytis cinereu i nešto manju osetljivost na Plasmopar vilicolu. Uz diskretan, fini cvetni miris, različit od mirisa vina Traminca, Mila je imala i bolje degustacione ocene vina. Nadmašila je Traminac i po otpornosti na niske zimske temperature, naročito krajem zime. Visok stepen otpornosti ovog kultivara na niske temperature tokom cele zime je rezultat povoljne kombinacije otpornosti roditeljskih partnera. Moglo bi se zaključiti da je Mila kultivar za visokokvalitetna aromatična bela vina, pogodan za gajenje na nižim terenima i depresijama gde se zadržavaju hladne vazdušne mase tokom zime, to jest gde je gajenje sorti istog tipa rizično zbog opasnosti od izmrzavanja.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLU SIB TEST KROS REKURENTNA SELEKCIJA MULTIGERMNIH TETRAPLOIDNIH OPRAŠIVAČA ŠEĆERNE REPE

 

L. KOVAČEV, N. ČAČIĆ i Snežana MEZEI

 

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Dalje povećanje genetičkog potencijala rodnosti i poboljšanje drugih agronomskih svojstava šećerne repe najvećim delom zavisi od: 1. Mogućnosti stvaranja ove genetičke varijabilnosti, 2. Proporcije superiornih genotipova u izvornoj populaciji, 3. Efikasnosti metoda selekcije koja će omogućiti povećanje frekvencije i kumulaciju poželjnih gena, identifikaciju i fiksaciju superiornih genotipova. Pošto se  hibridizaciji šećerne repe multigermne tetraploidne populacije koriste kao oprašivači tj. donori dva genoma u triploidnom hibridu njihova uloga u realizaciji finalnih karakteristika hibrida nesumnjivo je značajna. Rezultati istraživanja, iako se radi samo  jednom ciklusu ukazuju da polusib test kros rekurentna selekcija može biti efikasan metod u povećanju poželjnih gena, poboljšanju populacije per se i njenih kombinacionih sposobnosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KALUSOGENEZA KOD ŠEĆERNE REPE (Beta vulgaris L.)

 

B. KOVAČEVIĆ, Snežana MEZEI i Marija KRALJEVIĆ-BALALIĆ

 

Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Novi Sad

 

Šećerna repa (Beta vulgaris L.) je dikotiledona, dvogodišnja biljka iz familije Chenopodiaccae. Ispitivanje kalusogeneze kod šećerne repe je značajno u smislu efikasnijeg korišćenja metoda kulture tkiva i ćelija u procesu oplemenjivanja. Ispitivana su 3 genotipa tj. sintetičke populacije šećerne repe: 112A, 115 i 116A. To su diploidne, monogermne, autofertilne populacije. Za eksperiment su korišćeni eksplantati kotiledona, hipokotila i listova uzetih sa ponika starih 3 nedelje. Vrednosti dobijene u toku eksperimenta, kao što su procenat inicijacije kalusa i masa kalusa obrađene su korišćenjem nekoliko statističkih, pokazatelja i testova. Procenat inicijacije kalusa obrađen je programom STATGRAPHICS, pri čemu su procenti bili transformisani. Na osnovu dobijenih masa kalusa računata je stopa promene. Pošto je izračunate stope promena unutar pojedinih varijanata karakterisala velika varijabilnost, kao i zbog njihove nepodesnosti za transformaciju na adekvatan način urađeni su pojedinačni testovi značajnosti u vidu t-testa. Ispitivani su indukcija i rast kalusa u zavisnosti od genotipa izvora eksplantata i podloge. Kalusi su se razlikovali u zavisnosti od sastava i konzistencije podloge. Utvrđeno je da na stepen indukcije kalusa u tečnim podlogama značajno utiče sastav podloge i izvor eksplantata, a na podlogama čvrste konzistencije samo sastav podloge. Nije utvrđena značajna razlika u porastu kalusa u toku prve četiri i naredne četiri nedelje, kao ni između porasta kalusa poreklom od kotiledona i hipokotila populacije 112A. Uočen je značajan uticaj podloge na rast kalusa.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA KOMBINACIONIH SPOSOBNOSTI ZA BROJ ZRNA PŠENICE

 

Mirjana KRALJEVIĆ-BALALIĆ, M. DIMITRIJEVIĆ i Sofija PETROVIĆ

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Novi Sad

 

Urađena je 5x5 dialelna analiza, bez recipročnih ukrštanja, kako bi se došlo do saznanja o delovanju gena, opštim (OKS) i posebnim (PKS) kombinacionim sposobnostima za broj zrna po klasu pšenice. Ukršteno je pet genetički divergentnih genotipova pšenice sa različitim major genima za visinu stabljike (NS Rana 2, Bankut 1205, NS 732, Alias 66 i Siete Cerros 66). Deset F1 hibrida i njihovi roditelji su uzgajani u poljskim uslovima, po slučajnom blok sistemu, u tri ponavljanja. Analiza kombinacionih sposobnosti je rađena po Griffing-u (1956), metod 2, model I. Ispitani genotipovi su se značajno razlikovali u broju zrna po klasu. Aditivno i neaditivno delovanje gena je kontrolisalo ekspresiju broja zrna po klasu. Najvišu značajnu pozitivnu vrednost OKS pokazao je genotip Siete Cerros 66. Ukrštanja sa najboljim PKS vrednostima, NS Rana 2 x NS 7342 i Bankut 1205 x Siete Cerros 66, bi se mogla koristiti u daljem radu na oplemenjivanju pšenice.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KOMBINACIONE SPOSOBNOSTI I EFEKTI GENA ZA VOLUMEN KORENA PŠENICE

 

M. KUBUROVIĆ, M. PAVLOVIĆ i D. KNEŽEVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita "Kragujevac", Kragujevac

 

Uzimajući u obzir značaj i ulogu korenovog sistema u životu biljke, koren je ostao predmet mnogobrojnih istraživanja. U ovom radu je proučavan volumen korena kao značajan elemenat razvijenosti korenovog sistema. U tom cilju je urađeno dialelno ukrštanje (bez recipročnih) tri divergentne sorte pšenice (Sava, Libellula i Kruševačka 9083). U potomstvu F1 i F2 generacije ispitivan je način nasleđivanja, efekat gena i kombinacione sposobnosti za volumen korena pšenice. Analiza varijanse kombinacionih sposobnosti je urađena po Griffing-u, (1956) metod 2, model I, a regresiona analiza po metodi Mather & Jinks, (1971). Rezultati istraživanja pokazuju da parcijalna dominacija preovladava u nasleđivanju volumena korena. Analizom varijanse kombinacionih sposobnosti dobijene su visoko signifikantne opšte kombinacione sposobnosti, što znači da glavni deo genetičke varijanse čini aditivna komponenta. Sorta Sava ima najstabilniji volumen korena i predstavlja najboljeg opšteg kombinatora, od ispitivanih sorti. Izračunate vrednosti PKS pokazuju da ne postoje značajne razlike u dobijenom potomstvu za volumen korena. Linija regresije je dosta blizu limitirajuće parabole što potvrđuje navedeni stav da aditivna komponenta preovladava u nasleđivanju ovog svojstva. Presek linije regresije sa y osom je iznad koordinatnog početka što znači da je, uzevši u obzir sve kombinacije ukrštanja, parcijalna dominacija najčešći tip nasleđivanja volumena korena. Kod sorti Libellula i Kruševačka 9083 su zastupljeniji dominantani aleli, dok Sava poseduje više recesivnih alela za proučavano svojstvo. Raspored tačaka dijagrama rasturanja i vrednosti koeficijenta regresije ukazuju na odsustvo intcralelne interakcije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

INDUKCIJA HAPLOIDNOG KALUSA KOD ŠEĆERNE REPE

 

Nevenka KUPREŠANIN i Snežana MEZEI

 

Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Novi Sad

 

Cilj istraživanja bio je da se ispita uticaj dve podloge Cr (4,5 ηM, 2,4 D, 9,3ηM kin. i 0,5ηM GA3) i XII (4,5ηM, 2,4 D i 4,6ηM kin.) na procese kalusogeneze Rod 8 genotipova šećerne repe. Vršni delovi cvasti su sterilisani, nakon čega su vađene jajne ćelije iz pojedinačnih cvetova. Nakon 4 nedelje javile su se prve haploidne biljke. Kao početni eksplantati za indukciju kalusa korišćeni su listovi ovih biljaka. Eksplantati su gajeni u sterilnim uslovima, inokulirani na ispitivane podloge, koje su sadržale mikro i makro elemente po Gamborg-u (1965), 3% saharoze i 0,7% agara sa dodatkom stimulatora rasta. Veoma velika varijabilnost u pigmentaciji, teksturi i konzistenciji uočena je u kalusnim kulturama. Analizom varijanse utvrđeno je postojanje statistički značajnih razlika između genotipova, a naročito interakcija genotip/podloga. Na podlozi Cr najveći prirast mase kalusa dobijen je kod prvog ispitivanog genotipa, a najmanji kod četvrtog. Na podlozi XII najveći prirast mase kalusa dao je genotip 1, a najmanji genotip 2.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MOGUĆNOSTI PRIMENE RESTRIKTIVNIH SELEKCIJSKIH INDEKSA U POPULACIJAMA MLEČNIH GOVEDA

 

D. LATINOVIĆ 1, LJ. LAZAREVIĆ 1, P. STOJIĆ 2, G. TRIFUNOVIĆ 1 i M. KATIĆ 2

 

1 Poljoprivredni fakultet, Beograd - Zemun

2 Agroekonomik, Beograd

 

Za ilustraciju konstrukcije restriktivnih selekcijskih indeksa poslužio je slučajno odabrani uzorak bikova i krava crno belih goveda sa različitom proporcijom gena holštajn frizijske rase. Osnovni indeksi, varijanse i kovarijanse dobijeni su primenom programskog paketa "selind" (Cunningham, 1989) i metoda najmanjih kvadrata (Harvey, 1990). Indeksi bikova i krava su prikazani preko sledećih opštih izraza:

 

IB = b1χ1 + b2χ2

IB = b1χ1 + b2χ2 + b3χ3, u kojima su:

 

b1b2b3 = koeficijenti regresije

χ1 = prinos mleka u standardnoj laktaciji (kg)

χ2 = prinos mlečne masti u standardnoj laktaciji (kg)

χ3=  trajanje servis perioda (dana).

 

Restrikcija je postavljena na prinos mlečne masti, odnosno ova osobina je u indeksu posmatrana kao konstantna veličina (Dummy taril). Na osnovu rezultata dobijeni su sledeći indeksi:

 

Ibikova = 0,0157 χ1 + (-0,3441) χ2;

Ikrava = 0,0152 χ1 + (-(),3302) χ2+ (-0,0085) χ3

 

U daljim istraživanjima potrebno je uključivanje u indeks većeg broja ekonomski važnih osobina.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

FENOTIPSKO-FIZIOLOŠKA VARIJABILNOST 29 PROVENIJENCIJA DUGLAZIJE (Pseudotsuga laxifolia Britt.) U TEST KULTURAMA

 

Vera LAVADINOVIĆ, V. ISAJEV

 

Institut za šumarstvo i šumarski fakultet, Beograd

 

Polazeći od značaja provenijeničnih testova u introdukciji egzota pri oplemenjivanju alohtonih četinara, za šumarstvo Srbije duglazija je jedna od najznačajnijih vrsta. U cilju bližeg upoznavanja genetskog potencijala provenijencija duglazije za njeno usmereno korišćenje postavljen je ogled (1984. god.) sa 29 provenijencija ove vrste na dva lokaliteta (na Juhoru i u Tandi kod Bora). Testom su obuhvaćene provenijencije koje potiču iz čitavog areala duglazije, između 32,9° i 49° severne geografske širine, i sa istoka na zapad između 105,7 i 124° zapadne geografske dužine severno-američkog kontinenta. Izbor eksperimentalnih polja baziran je na klimi, karakteristikama zemljišta, nadmorskoj visini i vegetaciji. U cilju upoznavanja međuprovenijeničnog varijabiliteta kao i unutar provenijencija, analizirani su osnovni taksacioni podaci: prečnik u vratu korena, visina i tekući visinski prirast. Kontinuirano su praćene prolećne i jesenje fenofaze listanja kao i otpornost biljaka na rane i kasne mrazeve. Istraživanja fenotipsko-fiziološke varijabilnosti obavljena su u cilju pouzdanije selekcije odgovarajućih provenijencija za staništa u Srbiji. Na osnovu dobijenih rezultata u istraživanjima provenijencija u juvenilnom dobu, kao i na osnovu njihovog velikog genetskog potencijala planirano je u daljem radu pristupiti izdvajanju i trajnom obeležavanju test stabla. Ova stabla će biti objekat za višegodišnje analize redovnosti, obilnosti i kvaliteta uroda a kasnije za kloniranje i primenu hibridizacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MOGUĆNOSTI I OGRANIČENjA U GENETSKOM UNAPREĐENjU OSOBINA MLEČNOSTI U GOVEDA

 

LJ. LAZAREVIĆ

 

Poljoprivredni fakultet, Beograd-Zemun

 

Genetsko unapređenje osobina mlečnosti u goveda ima veliki privredni značaj i predmet je interesovanja kako odgajivača goveda tako i naučnika. Pri reprodukciji osemenjavanjem ono se pretežno ostvaruje preko kvalitetnih bikova. U razmatranju mogućnosti pažnja je posvećena genetskoj varijabilnosti, metodama ocene priplodne vrednosti bikova i krava i intenzivnoj selekciji, a od ograničenja ukazano je na uslove testa, veličinu aktivne populacije i inbriding. Dotaknut je mogući doprinos najnovijih saznanja kao što su transfer embriona i genetičko inženjerstvo.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ NIVOA MLEČNOSTI NA GENETSKU VARIJABILNOST

LJ. LAZAREVIĆ, D. LATINOVIĆ, G. TRIFUNOVIĆ, M. KATIĆ i P. STOJIĆ

Poljoprivredni fakultet, Beograd-Zemun

 

Ekspresija aditivnih efekata gena kvantitativnih osobina zavisi u bitnoj meri od spoljnih faktora. Taj problem je proučavan prcko tri nivoa mlečnosti. U populaciji crno-belih goveda formiran je uzorak od 5143 krave, kćeri od 21 bika. Prema mlečnosti u prvoj laktaciji sve krave su podeljene u tri grupe između kojih je postojala razlika u prosečnoj mlečnosti do 2.193 kg mleka. Analiza varijabilnosti osobina mlečnosti obavljena je korišćenjem mešovitog modela koji je uključivao uticaje bikova, farmi, godina, sezona, servis perioda i uzrasta. Heritabiliteti ispitivanih osobina, koji su pokazatelji razlika u aditivnim efektima gena, povećavali su se sa većom prosečnom mlečnošću. Oni su iznosili za prinos mleka 0,02 (nizak nivo) do 0,17 (visok nivo), a za prinos mleka sa 4% mlečne masti (MKM) 0,04 do 0,19. Zaključeno je da bolji uslovi gajenja  i  ishrane  omogućavaju  potpunije  ispoljavanje aditivnih  efekata  gena  i efikasniju selekciju.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOST CRVENE DETELINE (Trifolium pratense L.) NA PROCES BIOLOŠKE FIKSACIJE AZOTA

 

Z. LUGIĆ 1, Kosana KOSTANTINOV 2, M. IVANOVIĆ 2, i G. MILOŠEVIĆ l

 

1 Institut za istraživanja u poljoprivredi "SRBIJA" - Beograd, Centar za krmno bilje, Kruševac

2 Institut za kukuruz "Zemun Polje", Beograd-Zemun

 

Ispitivana je varijabilnost između i unutar kultivara crvene deteline (Trifolium pratense L.) za nivo biološke fiksacije azota. U istraživanjima su korišćena četiri kultivara, dva diploidna (K-17 i Reichersberger) i dva tetraploidna (K-27 i K-31). Istraživanja su obavljena u polukontrolisanim uslovima. Biljke su gajene na termički sterilisanoj podlozi (kvarcni pesak + perlit u zapreminskom odnosu 1:1) u sudovima zapremine 6 litara. Inokulacija je obavljena aktivnim sojem Rhizobium trifolii br. 424. Prihranjivanje je vršeno hranljivim rastvorom po Reid-Yorku, bez azota. Biljke su, po potrebi zalivane destilovanom vodom. Devedeset dana nakon setve izvršena je žetva biljaka na 2 cm iznad podloge. Na trideset biljaka od svakog kultivara mereni su sledeći pokazatelji intenziteta biološke fiksacije azota: masa suve biljke, visina biljke, masa suvog korena, dužina korena, broj nodula, sadržaj sirovih proteina i aktivnost nitrogenaze. Testirane su značajnosti razlika između kultivara i koeficijenti korelacije za ispitivane osobine primenom T-testa. U početnim fazama razvoja razlike između biljaka i kultivara su bile male, a sa starenjem su se povećavale, tako da su u momentu žetve bile izražene. Tetraploidni kultivari, a naročito kultivar K-27, su ostvarili značajno veći prinos suve mase od diploiodnih. Zapažena je visoka varijabilnost kultivara i pojedinačnih biljaka za prinos suve mase po biljci, masu korena i broj nudula. Nešto manja varijabilnost je registrovana za visinu biljke i aktivnost nitrogenaze, dok su variranja za dužinu korena i sadržaj sirovih proteina bila izuzetno niska. Pouzdane korelacije srednje jačine su zabeležene za prinos suve mase po biljci, visinu biljke, masu korena i broj nodula, dok je korelacija za prinos suve mase i sadržaj sirovih proteina negativna i pouzdana. Za masu korena i većinu ispitivanih osobina su zabeležene slabe, do srednje jake korelacije, ali pouzdane do vrlo pouzdane. Korelacije za aktivnost nitrogenaze i ostale parametre su bile srednje, do jake, ali su zbog malog broja korelacionih parova pouzdane samo za sadržaj sirovih proteina. Obzirom na to da je uticaj faktora spoljašnje sredine na proces azotofiksacije isti za sve biljke, to se sve razlike između i unutar kultivara mogu pripisati genotipu makrosimbionta, to jest njegovoj sposobnosti da sa primenjenim bakterijskim sojem, u datim uslovima uspostavi simbiozni odnos.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NASLEĐIVANJE VISINE STABLA KOD HIBRIDA JEČMA (Hordeum vulgare L.)

 

Milomirka MADIĆ 1 i M. PAVLOVIĆ 2

 

Agronomski fakultet - Čačak

Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita "Kragujevac", Kragujevac

 

Dialelnim ukrštanjem četiri divergentna genotipa ječma dobijeno je potomstvo F1 i F2 generacije pri čemu je ispitivan način nasleđivanja, efekti gena I heritabilnost za visinu stabla. Analiza statističkih parametara je urađena po Hayman-u (1954), Jinks-u (1954) i Mather-u and Jinks-u (1971). Dobijeni rezultati ukazuju da je način nasleđivanja visine stabla ječma različit (parcijalna dominacija, dominacija I superdominacija) pri čemu preovladava superdominacija uz pojavu heterozisa. Uzevši u obzir sve kombinacije ukrštanja glavni deo genetičke varijanse pripada dominantnoj komponenti, pri čemu u ekspresiji ovog svojstva preovlađuju dominantni nad recesivnim alelima. Prosečni stepen dominacije ukazuje da se u nasleđivanju visine stabla ječma radi o superdominaciji uzevši u obzir sve kombinacije ukrštanja. Linija regresije je znatno udaljena od limitirajuće parabole što pokazuje da je genski sistem za nasleđivanje visine stabla ječma dominantan. Presek linije regresije sa y osom se nalazi ispod koordinatnog početka što potvrđuje iznete konstatacije da se u nasleđivanju ove osobine radi o superdominaciji, uzevši u obzir sve kombinacije ukrštanja. Raspored tačaka dijagrama rasturanja duž očekivane linije regresije govori o genetičkoj divergentnosti roditelja, koji se međusobno razlikuju u rasporedu dominantnih i recesivnih gena za visinu stabla. Heritabilnost iznosi 42%, tako da na izraženost visine stabla ječma značajno utiču faktori spoljašnje sredine.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KORELACIJE I ANALIZA KOEFICIJENTA PUTANJE KOD RICINUSA (Ricinus communis L.)

 
R. MARINKOVIĆ, D. ŠKORIĆ, J. CRNOBARAC i N. DUŠANIĆ

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Proučavana je uzajamna povezanost nekih svojstava biljke i semena (visina biljke, visina grozda, broj listova po biljci), broj semena po biljci, masa 1000 semena, sadržaj jezgra u semenu) i njihove korelacije sa prinosom semena po biljci. Pozitivna visoko signifikantna korelacija otkrivena je samo između prinosa semena po biljci i mase 1000 semena. Sva ostala svojstva su bila u negativnoj, a visina biljke i broj listova po biljci u signifikantnoj negativnoj korelaciji sa prinosom semena. Analiza koeficijenta putanje (Path-coefficient analysis) otkrila je da je najveći direktni pozitivni efekat na prinos semena ispoljila visina biljke. Broj semena po biljci ispoljio je takođe pozitivan, ali ne tako velik, direktan efekat na prinos semena. Sva ostala ispitivanja ispoljili su negativan direktan efekat na prinos semena.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MEĐUZAVISNOST MORFO-ANATOMSKIH OSOBINA VRŠNOG LISTA I NEKIH KOMPONENTI PRINOSA PŠENICE


Ljiljana MERKULOV 1, Jadranka IVEZIĆ l i Marija KRALJEVIĆ-BALALIĆ 2

 

Inslitut za biologiju, PMF, Novi Sad

2 Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Novi Sad

 

Selekcija u cilju dobijanja visokoprinosnih genotipova podrazumeva pored ostalog i dobro poznavanje strukturno-fizioloških osobina lista, imajući u vidu njegovu ulogu u sintezi organskih materija a time svakako i formiranju prinosa. U tom pogledu veoma je značajna uloga vršnog lista-zastavičara koji je po položaju u neposrednoj vezi sa klasom i direktno ga snabdeva asimilatima. U radu su ispitivane morfo-anatomske osobine vršnog lista kod različitih genotipova pšenice u cilju utvrđivanja stepena međuzavisnosti ovih osobina i nekih komponenti prinosa. Za proučavanje je korišćeno 10 genotipova pšenice, različitog geografskog porekla, uzgajanih na oglednom polju Instituta za ratarstvo i povrtarstvo, na Rimskim Šančevima u 1991/92 godini. Materijal za analizu uziman je tokom meseca jula. Merenje lisne površine izvršeno je aparatom Li 3000 Paroble Arcameter USA. Za ispitivanje anatomske građe, mikrotomom na zamrzavanje pravljeni su poprečni preseci srednjeg dela liske i na njima izvršena mikroskopska merenja. Osobine stomatalnog aparata analizirane su na otiscima epidermisa dobijenim po metodi Wolf-a. Rezultati ispitivanja ukazuju na značajne genetičke razlike u veličini lisne površine, veličini stoma, broju stoma po mm, ukupnom broju stoma liske, debljini mezofila kao i veličini provodnih snopića. Ustanovljena je značajna negativna korelacija između broja stoma po jedinici površine i prinosa. Između debljine mezofila i prinosa postoji negativna korelacija, dok je između lisne površine kao i površine snopića i prinosa pozitivna ali nije statistički značajna.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETSKA VARIJABILNOST PŠENICE U STVARANJU PRIRODNIH ASOCIJACIJA SA SLOBODNIM DIAZOTROFIMA

 

Danica MIĆANOVIĆ 1, Zora SARIĆ 2, M. SARIĆ 3 i V. MITROVIĆ 4

 

1 Institut za istraživanja u poljoprivredi "Srbija" - Centar za strna žita "Kragujevac", Kragujevac

2 Poljoprivredni fakultet u Novom Sadu, Novi Sad

3 Srpska Akademija nauka i umetnosti, Beograd

4 Institut za istraživanja u poljoprivredi "Srbija", Centar za voćarstvo, Čačak

 

Sposobnost razvoja genotipa Triticum aestivum u prirodnim asocijacijama sa slobodnim diazotrofima omogućava selekcija efektivnih asocijacija genotip - soj na najvažnije svojstvo za vezivanje azota iz atmosfere, nitrogenaznu aktivnost. Ispitivanja su izvedena u Centru za strna žita, Kragujevac, sa deset sorata pšenice: KG-56, Srbijanka, Skopljanka, Studenica, Tamiš, Sana, Jugoslavija, Evropa, NS-rana, Partizanka. Biljke su gajene in vitro u vodenim kulturama sa razloženim rastvorom Reid-York, set azota. Kroz dva sukcesivna ogleda izvršeno je prenošenje diazotrofa sa korena pšenice gajene na drugu generaciju pšenice (gajene in vitro). Nitrogenazna aktivnost je određena na gasnom hromatografu metodom acetilen - etilen analize asocijacije. Nitrogenazna aktivnost je varirala između ispitivanih genotip - soj u oba ogleda. Najveća nitrogenazna aktivnost u prvom ogledu iznosila je 62,5 amol C2//4gr svežeg korena. U drugom ogledu najveća nitrogenazna aktivnost je iznosila 420 amol C2//4gr svežeg korena. Na osnovu naših rezultata možemo zaključiti da su ispitivani genotipovi sposobni da "odabiraju", stimulišu određenu multiplikaciju diazotrofa iz svoje rizosfere.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ATROFIJA SEMENIH ZAMETAKA U CVETOVIMA SA PREKINUTIM RAZVOJEM KOD ŠLjIVE (P. domestica L.)

 

N. MIŠIĆ R. CEROVIĆ i Gordana ĐURIĆ

 

Inslitut za istraživanja u poljoprivredi "Srbija", Centar za voćarstvo i vinogradarstvo, Čačak

 

U toku proučavanja razvoja cvetova različitih sorti šljive uočena je pojava prekida u razvoju cvetova cv. Pozegača i cv. Čačanske Rodne, a koja se javlja od početka fenofaze balona do punog cvetanja. Pojava zaustavljanja u razvoju kruničnih i čašičnih listića i filamenata imala je za posledicu formiranje atipičnih cvetova koji su neposredno no cvetanju otpali. Histološke analize atipičnih cvetova u odnosu na normalne pokazuju pojavu atrofije semenih zametaka. Prvi simptomi atrofije uočavaju se u cvetova uzetih u fenofazi balona. Histološke analize ovih cvetova pokazuju normalno razvijen muški i ženski gametofit sa prisutnom pojavom početka atrofije semenih zametaka u zoni halaznog dela nucleusa. Sa nastupanjem fenofaze cvetanja atrofija nucleusa se progresivno širi i na integumente, a u fazi punog cvetanja zahvata i emrionovu kesicu. Na osnovu razvijenosti struktura embrionovih kesica u atipičnim cvetovima može se zaključiti da opisana pojava atrofije semenih zametaka nije nastala kao posledica poremećaja u razvoju embrionove kesice ili pod njenim uticajem.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

DEFORMITETI PLODNIKA ŠLjIVE USLOVLJENI NEPRAVILNIM SRASTANJEM KARPELE

 

N. MIĆIĆ, R. CEROVIĆ i Gordana ĐURIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za voćarstvo i vinogradarstvo, Čačak

 

U pojedinih sorti šljive prisutna je pojava formiranja plodova sa različitim stepenom deformiteta u zoni brazde ploda i delimično otvorenih ili raspuklih plodova, što jasno indicira da se oni javljaju kao posledica poremećaja u toku srastanja rubova karpele. Histološke analize pokazuju različite nepravilnosti u toku proces srastanja karpele koje se odvija istovremeno sa početnim fazama diferencijacije primordija semenih zametaka, kao i u periodu punog cvetanja. Opaženi poremećaji u srastanju karpele mogu se grupisati u tri grupe: (1) potpuno srastanje različitih kontaktnih zona ruba karpele; (2) delimično srastanje samih rubova karpele; (3) karpela nije srasla celom dužinom plodnika (od zone obturatora do baze plodnika). U sve tri grupe prisutni su normalno razvijeni semeni zameci sa embrionovim kesicama. Sem ispoljenih uticaja na morfologiju ploda poremećaji u srastanju karpele mogu imati za posledicu i formiranje različitog broja semenih zametaka, kao i različit položaj semenih zametaka u lokuli plodnika.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NUKLEARNI I EKSTRANUKLEARNI FAKTORI KAO UZROK ŽUTE PEGAVOSTI LISTOVA SUNCOKRETA (H. annum L.)

 

M. MIHALJČEVIĆ

 

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Albinizam i hlorotične promene na lišću inbred linija predstavljaju uobičajenu posledicu kontinuirane samooplodnje stranooplodnih biljaka. Pojava žutih sektora ili pega na listovima suncokreta može biti izazvana delovanjem parazita, hemijskim agensima ili se javlja kao posledica delovanja naslednih faktora. Direktnim i recipročnim ukrštanjem genotipa RHA-CD-YLW (list sa žutim pegama) sa standardom (list zelene boje) dobijene su u F1 generaciji biljke sa zelenim listovima. U ukrštanjima genotipa XMAC-27 sa standardom utvrđene su u F1 značajne razlike između direktnih i recipročnih ukrštanja. Samooplođene biljke sa hlorotičnim sektorima daju u potomstvu biljke po fenotipu slične sebi, kao i biljke sa albino i zelenim listovima i to u različitim i nestabilnim odnosima. Hlorotični sektori se javljaju kao posledica delovanja ekstranuklearnih faktora i nasleđuju se striktno po majčinskoj liniji. Dokazan je uticaj somatske segregacije na povećan broj letalnih albino biljaka. Najveći broj albino jedinki vodi poreklo od semena iz albino sektora glavica (>90%) i iz mešovitih sektora (>40%).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

BUDUĆE POTREBE ZA PROMENE KONCEPCIJE I METODA OPLEMENJIVANJA BILJAKA

 

I. MIHALJEV, Marija KRALJEVIĆ-BALALIĆ, P. DORIĆ i S. PETROVIĆ

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Novi Sad

 

U ovom veku u oplemenjivanju biljaka je postignut izvanredan napredak. Stvoren je veliki broj sorti i hibrida povoljnih agronomskih osobina, a potencijal za prinos je kod mnogih vrsta rastao no stopi od 1% godišnje. U narednim decenijama pred oplemenjivanje biljaka postavljaju se novi zadaci. Stoga treba planirati promene u koncepciji i metodama stvaranja novih sorti. U pogledu koncepcije treba zadovoljiti zahteve koji su rezultat nastalih promena u savremenom svetu, a koji se mogu iskazati sa nekoliko glavnih pravaca: prilagoditi se globalnim klimatskim promenama, očuvati ekološku sredinu od zagađenja, povećati zdravstvenu bezbednost i nutritivni kvalitet hrane, povećati nivo i stabilnost prinosa, a uz sve to racionalizovati - povećati profitabilnost proizvodnje. U pogledu metoda i tehnika oplemenjivanja biljaka, zahvaljujući novim saznanjima u oblasti kultura "in vitro", citogenetike, molekularne genetike i genetskog inženjerstva, proširuju se mogućnosti da se pored poboljšanja konvencionalnih metoda oplemenjivanja, uvode i nove metode i tehnike. Imajući ovo u vidu u radu se kao mogući putevi ostvarivanja savremenih i zahteva identifikuju: stvaranje otpornih sorti na bolesti i štetočine, biološko suzbijanje patogenih organizama, stvaranje ekonomičnih sorti, fiksacija atmosferskog azota od neleguminoznih biljaka, iskorišćavanje heterozisa genetskim mehanizmima, stvaranje sorti pogodnih za mehanizovanu proizvodnju i oplemenjivanje i uvođenje u proizvodnju novih biljnih vrsti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOST PRINOSA GROŽĐA I SADRŽAJA PIGMENATA HLOROPLASTA U HIBRIDNOM POTOMSTVU VINOVE LOZE (Vitis sp.)

 

M. MILUTINOVIĆ, Ružica DŽAMIĆ, L. AVRAMOV, D. NIKOLIĆ i M. NIKOLIĆ

Poljoprivredni fakultet, Beograd – Zemun

 

U programu oplemenjivanja vinove loze primenjuje se i međuvrsna hibridizacija u cilju stvaranja novih sorti otpornih na bolesti i nepovoljne ekološke uslove, a sa izraženim prinosom i kvalitetom grožđa. U ovom radu prikazani su rezultati istraživanja u odnosu na variranje prinosa, sadržaja hlorofila, karotenoida i odnosa chl.a/b i chl.a+b/karot. kod međuvrsnih hibrida F1 generacije, dobivene ukrštanjem S.V.18315 x Muskat hamburg. Prinos grožđa po čokotu meren je u vreme pune zrelosti, a dinamika sadržaja fotosintetskih pigmenata lista praćena je u dve fenofaze (cvetanje i porast bobica). Njihov sadržaj izražen je kroz srednje vrednosti. Hlorofil i karotenoidi kvantitativno su određeni spektrofotometrijski, ekstrakcijom u acetonu (Wetsttein, 1957). Prinos grožđa po čokotu kod sejanaca kretao se od 0,86 do 6,80 kg, a kod roditeljskih partnera od 3,18 do 4,37 kg. Sadržaj hlorofila bio je najveći u lišću Muskat hamburga (5,15 mg/g), a kod većie sejanaca on se kretao u granicama drugog roditelja S.V.18315 (4,74 mg/g). Odnos hlorofila a/b nije se značajnije menjao u odnosu na roditeljske partnere. Slična relacija ustanovljena je i za sadržaj karotenoida. Na osnovu izračunatih koeficijenata varijacije može se konstatovati da najveći varijabilitet ima prinos (CV = 62,91%), a najmanji sadržaj karotenoida (CV = 3,72%). Koeficijent korelacije između prinosa i odnosa hlorofila a/b (r = 0,41) pokazao je srednje izraženu zavisnost, dok koeficijenti korelacije između prinosa i sadržaja hlorofila (r = 0,26) i prinosa i sadržaja karotenoida (r = 0,09) ukazuju da ne postoji značajnija zavisnost između navedenih poligenski determinisanih osobina.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MULTIVARIJACIONA ANALIZA NEKIH POPULACIJA DIVLJE TREŠNjE (Prunus avium L.)

 

M. MILUTINOVIĆ, Gordana ŠURLAN-MOMIROVIĆ, N. RALEVIĆ, Ivana RALEVIĆ i Vera RAKONJAC

Poljoprivredni fakultet, Beograd - Zemun

 

Kolekcionisano je nekoliko populacija divlje trešnje (Prunus avium L.) sa područja Srbije. Analizirana je varijabilnost osam morfoloških osobina. Takođe je određen diskriminacioni efekat tih osobina pomoću multivarijacione analize. Rezultati klasifikacije dobijene na osnovu linearnih i diskriminacionih funkcija pokazuju da postoji mala razlika između stvarnih i ocenjenih grupa. Slične populacije klasifikovane su prema rezultatima analize Euklid-ove distance.

Dobijeni rezultati ukazuju na precizno razdvajanje na klastere dobijene numeričkom metodom i procenom kolekcije germplazme divlje trešnje.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

SELEKCIJA ORAHA Juglans regia L. U SRBIJI

 

A.M. MIRKOVIĆ, R.R. TODOROVIĆ, P.D. MIŠIĆ, Z.V. PAVLOVIĆ i N.G. ZEC

 

 Zavod za voćarstvo i vinogradarstvo, Institut "Agroekonomik", Beograd

 

Obični orah je voćka veoma duge filogeneze. Njihova jezgra imaju veliku hranljivu vrednost. Proizvodnja oraha u Jugoslaviji je deficitarna. Cilj selekcije oraha iz polimorfne prirodne populacije u Srbiji je: vitalnost, kasno listanje, velika rodnost i visok randman jezgre. Dvadeset vitalnih selekcija oraha odabrano je od 1983. do 1991. godine. Najbolje selekcije su: 37/MP/83 (Mali Popovid), Z/206/87 (Zlot), V/204/87 (Vlasotince), S901 i S902 (Stubal, Aleksandrovac). Selekcija Z/206/87 kasno lista (početkom maja), S901 odlično rada (250 kg/stablo), a V/204/87 ima visok randman jezgre (64%).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EKONOMSKE I BIOLOŠKE KARAKTERISTIKE NEKIH SELEKCIJA ORAHA

 

M. MITROVIĆ

Centar za voćarstvo i vinogradarstvo - Čačak, Čačak

 

U Jugoslaviji postoji velika prirodna populacija oraha. Zbog velikog interesovanja za gajenje oraha u poslednjih 15 godina, bilo je neophodno selekcionisati ovu voćnu vrstu. Rad na selekciji oraha sprovodi se u nekoliko naučno-istraživačkih centara u Jugoslaviji. Klonskom selekcijom dobijeno je na stotine tipova oraha sa interesantnim ekonomskim i biološkim karakteristikama. Detaljno je proučeno oko 110 tipova. Iz ove grupe je izdvojeno 6 tipova koji su priznati za prve jugoslovenske sorte oraha. Centar za voćarstvo i vinogradarstvo u Čačku bavi se klonskom selekcijom oraha već duži niz godina, a zadnjih godina uvedena je i planska hibridizacija. Od svih selekcionisanih tipova, detaljnije ćemo opisati sledećih 5 tipova oraha koji su se istakli po svojim karakteristikama: Tip 5/79 - Vrba, pozni, rodni tip; Tip 7/88 - Ljubić, rodni, racemozni tip; Tip 11/89 - Milićevci, visoko rodni tip; Tip 12/90 - Jezdina, visoko rodni, racemozni tip; Tip 1/90 - Kablar, pozni, visoko rodni tip.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KOMPATIBILNOST HIBRIDA ŽEĆERNE REPE I SOJEVA Azotobactera

 

Nastasija MAKOVAČKI, Snežana MEZEI i L. KOVAČEV

 

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Šećerna repa za normalni rast i razviće koristi amonijačni ili nitratni oblik azota, koji se dodaje u vidu mineralnih đubriva. Praktični značaj azota u metaboličkim procesima kod Šećerne repe je kao i kod ostalih biljnih vrsta u sintezi aminokiselina, odnosno belančevina. Rezultati mnogih autora govore o povećanju usvojenog azota primenom inokulacije azotofiksatorima. U selekcionom programu šećerne repe bila bi korisna identifikacija takvih genotipova koji su sposobni da u ishrani deo neophodnog mineralnog azota zamene elementarnim azotom iz vazduha. Ovakva asocijativna azotofiksacija omogućila bi stvaranje takvih hibrida koji bi i pri smanjenoj upotrebi mineralnih hraniva obezbedili visoke i stabilne prinose. Cilj rada je bio da se iz rizosfere 2 ispitivana hibrida izoluju sojevi Azotobactera sp. i testira njihova kompatibilnost sa hibridima. Ispitan je specifičan odnos 7 sojeva Azotobactera (1,2,3, 5, 8, 12, 13) izolovanih iz rizosfere korena dve ispitivane hibridne sorte NS Hy 11 i Dana. Praćeno je kretanje delija Azoiobactera prema korenu biljke različite starosti nakon 2 i 4 nedelje. Određena je aktivnost nitrogenaze u čistim kulturama. Najveću aktivnost nilrogenaze u čistoj kulturi ostvario je soj 3, a zatim sojevi 13, 8 i 1. Prema obrastanju korena kod hibrida NS Hy 11 sojevi 3 i 8 su nakon 14 i 28 dana od inokulacije dali najintenzivnije obrastanje, što je u korelaciji sa aktivnošću nitrogenaze u čistoj kulturi. Kod hibridne sorte Dana uočeno je slično intenzivno obrastanje kod svih sojeva osim soja 13, kod koga uopšte nije došlo do obrastanja. Ovi rezultati pokazuju da je hibrid Dana kompatibilniji sa svim ispitivanim sojevima Azotobactera od NS Hy 11.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PROCENA MOGUĆNOSTI KORIŠĆENJA ANATOMSKE GRAĐE LISKE U SELEKCIJI TOPOLA

 

S. ORLOVIĆ, V. GUZINA

Naučni institut za topolarstvo, Novi Sad

 

U radu su prikazani rezultati istraživanja varijabilnosti debljine epidermalnog, palisadnog, sunđerastog i hipodermalnog tkiva, učešće fotosintetički aktivnih i tkiva, broj, dužina i širina stoma, prečnici i visine jednogodišnjih ožiljenica kao i proizvedena biomasa šest klonova topola i to: cl.53/86, cl.54/86 (P. nigra); cl M-l i cv. zelena robusta (P. x euramericana) i cl.PE 19/66 i S 1-8 (P. deltoides). Konstatovane su razlike između klonova u pogledu istraživanja parametara anatomske građe liske, stoma i biomase jednogodišnjih ožiljenica kao i veze između njih. Utvrđeno je da najveći broj stoma po mm2 na lišću lista imaju klonovi P. deltoides, zatim P. x euramericcma pa onda P. nigra, dok na naličju lista u tom pogledu nema pravilnosti. Duzina i širina stoma su najveće kod klonova P. nigra a najmanje kod P. deltoides. Klonovi P. euramericana se u ovom pogledu ponašaju uglavnom intermedijarno. Najveće učešće fotosintetički aktivnih tkiva kao i najveću proizvedenu biomasu u suvom stanju imaju klonovi P. deltoides. Cluster analiza je pokazala grupisanje klonova na P. nigra, P. x euramericana i P. deltoides, što upućuje na izražene specifičnosti proučavanih vrsta. Rezultati sugerišu na mogućnost korišćenja anatomskih karakteristika liske i stoma u selekciji genotipova topola na poželjna svojstva. Tek će se na osnovu rezultata eksperimentalnih istraživanja moći preciznije definisati koji su to elementi anatomske građe liske u užoj vezi sa poželjnim svojstvima koje su predmet selekcije topola.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

HIBRIDI KUKURUZA KOKIČARA – STVARANJE I ISKORIŠĆAVANJE


Zorica PAJIĆ i M. BABIĆ

 

Institut za kukuruz "Zemun Polje", Beograd-Zemun

 

Kukuruz kokičar je specijalna vrsta tvrdunca koji se razlikuje od običnog kukuruza po tome što formira krupne "kokice" posle eksplozije zrna, kao odgovor na zagrevanje. Hibridi kukuruza kokičara imaju veći prinos i visoku zapreminu kokičavosti, tako da mogu da ekonomski opravdaju proizvodnju. Da bi se postigao maksimalan potencijal kokičavosti, potrebno je da se berba obavlja kada je vlaga zrna ispod 20%, da perikarp zrna ostane neoštećen i da vlaga zrna u momentu kokanja bude od 13-14%.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKI EFEKTI I NASLEĐIVANjE DEBLJINE SKLERENHIMSKOG SLOJA U STABLU PŠENICE

 

M. PAVLOVIĆ, M. KUBUROVIĆ, D. KNEŽEVIĆ i Veselinka ZEČEVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita, "Kragujevac", Kragujevac

 

Otpornost na poleganje pšenice predstavlja kompleksno svojstvo determinisano skupom morfo-anatomskih osobina stabla. Ovo svojstvo je genetički kontrolisano, na čije ispoljavanje utiču i faktori spoljašnje sredine, sklerenhimski sloj u stablu pšenice se nalazi neposredno ispod epideremisa i čine ga ćelije sa lignificiranim zidovima, grupisane u nekoliko redova. Obzirom da ne poseduju protoplazmu, njihova osnovna uloga je da doprinose čvrstini stabla dajući mu mehaničku potporu. Dialelno ukrštanje (bez recipročnih) četiri divergentna genotipa pšenice (KG-75, Jugoslavija, Baranjka, NS-322) korišćeno je za proučavanje načina nasleđivanja, efekta gena i kombinacionih sposobnosti debljine sklerenhima u F2 generaciji. Analiza varijanse kombinacionih sposobnosti je rađena po Griffing-u (1956), metod 2, model I, a regresiona analiza metodom Mather and Jinks (1971). Testiranjem srednjih vrednosti potomstva u odnosu na roditeljski prosek vidimo daje najčešći način nasleđivanja superdominacija roditelja sa manjom debljinom sklerenhimskog sloja. Linija regresije je znatno udaljena od limitirajuće parabole što ukazuje da u nasleđivanju ove osobine preovlađuje dominantna komponenta. Presek očekivane linije regresije sa y osom se nalazi ispod koordinatnog početka, što govori o superdominaciji u nasleđivanju debljine sklerenhimskog sloja. Tačke dijagrama rasturanja se nalaze unutar limitirajuće parabole, a njihov raspored nam ukazuje na genetičku divergentnost između roditelja. Kod sorte KG-75 su zastupljeni dominantni, a kod Baranjke recesivni aleli za ispitivano svojstvo. Raspored tačaka dijagrama rasturanja sa grafikona WrW’ i vrednost koeficijenta regresije ukazuju na prisustvo interalelne interakcije. Analiza varijanse kombinacionih sposobnosti pokazuje visoko signifikantne PKS što samo potvrduje ulogu neaditivnih genskih efekata u nasleđivanju debljine sklerenhima. Najveću vrednost OKS imala je sorta Jugoslavija, dok su PKS vrednosti bile uglavnom negativne, što nam ukazuje da je varijansa u ovim ukrštanjima bila neaditivnog porekla.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NASLEĐIVANjE VISINE STABLA KOD HIBRIDA PŠENICE U F3 I F4 GENERACIJI

 

V. PEŠIĆ i Dragica ZORIĆ


Poljoprivredni fakultet, Beograd-Zemun

 

U radu je proučavano nasleđivanje, efekata gena i heritabilnost za visinu biljaka pšenice u 15 kombinacija ukrštanja. Te kombinacije su sledeće: a) 4 kombinacije ukrštanja od po dve sorte (Beograđanka, Agrounija, Rana niska, KG-56); b) 8 kombinacija ukrštanja od po tri sorte (Zemunka, Rana niska, Marija, Agrounija, Zadruga, Partizanka, Skopljanka, Panorama, Nizija); c) 4 kombinacije ukrštanja od po četiri sorte - složena ukrštanja (Zadruga, Lasta, Rana niska, Nizija, Partizanka, Agrounija, Marija, Zemunka 1). Izdvajanje i izbor linija obavljeno je 1991. i 1992. godine po Pedigre metodi. Urađena je distribucija frekvencije za sve kombinacije ukrštanja za osobinu visine stabla kod pšenice u F3 generaciji i pojedine linije u F4 generaciji. Ustanovljene su značajne razlike između srednjih vrednosti roditelja. Srednje vrednosti u F3 generaciji su u okviru vrednosti roditelja i sa većom varijabilnošću osobina u toj generaciji. Analiza dobijenih rezultata pokazuje da se visina stabla najčešće nasleđuje parcijalno dominantno intermedijarno. U nekim kombinacijama je došlo do pojave transgresivnog razdvajanja. U nasleđivanju visine stabla svoj uticaj ispoljavaju i aditivna i neaditivna komponenta samo sa različitim učešćem. Izračunata vrednost za heritabilnost je relativno visoka što ukazuje da je ova osobina u znatnoj meri genetički kontrolisana.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

OCENA DIVERGENCIJE DONORA NOSILACA POŽELjNIH ALELA ZA POPRAVKU PRINOSA ZRNA NEKIH ZP HIBRIDA KUKURUZA (Zea mays L.)

 

R. PETROVIĆ, N. DELIĆ i M. VIDAKOVIĆ

 

Institut za kukuruz "Zemun Polje", Beograd-Zemun

 

U cilju procene i popravke tri ZP hibrida, nekoliko genotipova je ukršteno sa roditeljima ZP hibrida. Relativna vrednost poželjnih (dominantnih) i nepozljnih (recesivnih) gena (alela) su ocenjene za nekoliko genotipova kao potencijalnih donora poželjnih alela. Na bazi analize prosečnih vrednosti prinosa zrna (Dudley, J.W. 1987b) izabrali smo samo nekoliko genotipova koji sadrže poželjne alele za prinos zrna u odnosu na elitne hibride, hibride izabrane za popravku. Na taj način moguće je značajno skratiti proces selekcije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NAČIN NASLEĐIVANjA I KOMPONENTE FENOTIPSKE VARIJABILNOSTI ZA BROJ ZRNA PO KLASU PŠENICE

 

Sofija PETROVIĆ, Marija KRALJEVIĆ-BALALIĆ i M. DIMITRIJEVIĆ

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Novi Sad

 

Dialelno je ukršteno pet različitih sorata pšenice (NS Rana-2, Bankut 1205, NS 732, Atlas 66 i Siete Cerros) sa ciljem da se ispita način nasleđivanja i komponente fenotipske varijabilnosti broja zrna po klasu. U F1 potomstvima svih ukrštanja je ispoljena dominacija, a u jednom delu potomstvima i superdominacija. Analiza komponenata varijanse pokazuje da u ekspresiji posmatranog svojstva preovlađuju dominantni nad recesivnim genima, odnosno da glavni deo genetičke varijanse pripada dominantnom delovanju gena. Uočava se i nejednak raspored pozitivnih i negativnih dominantnih alela kod roditelja. Izračunata vrednost prosečnog stepena dominacije ukazuje da se u nasleđivanju broja zrna po klasu, u ukrštanjima navedenih genotipova, radi o superdominaciji.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETSKI PARAMETRI OSOBINA TELESNE RAZVIJENOSTI ŽENSKOG PODMLATKA GOVEDA

 

M.M. PETROVIĆ, R. LAZAREVIĆ, LJ. LAZAREVIĆ 1 S. VASOVIĆ, B. MIŠČEVIĆ, S. ALEKSIĆ, D. RADOSAVLJEVIĆ

 

Naučni institut za stočarstvo, Beograd-Zemun

1 Poljoprivredni fakultet, Beograd-Zemun

 

Efekat direktne i indirektne selekcije kvantitativnih osobina telesne razvijenosti podmlatka goveda zavisi, pored ostalog, od nivoa heritabiliteta i genetske povezanosti svojstava. Visina koeficijenta heritabiliteta utiče na izbor metoda odgajivanja a u cilju poboljšanja ekonomnskih važnih osobina goveda. Proučavanje genetskih parametara, odnosno proučavanje aditivne genetske varijanse u ukupnoj fenotipskoj i genetskih korelacija je obavljeno u zapatu goveda crno bele rase. Istraživanje je obuhvatilo 200 grla, kćeri 8 bikova - očeva, u uzrastu od 4, 9, 14 i 24 meseca. Ispitivanjem je obuhvaćeno više osobina telesne razvijenosti, telesna masa, visina grebena, leda i krsta, dužina trupa, širina grudi i kukova, kao dubina i obim grudi. Genetski parametri su ocenjeni iz komponenata varijansi očeva pomoću modela 1 (fiksni model), primenom metoda najmanjih kvadrata (Harvey, 1987). Udeo aditivne genetske u ukupnoj fenotipskoj varijabilnosli je bio promenljiv u različitim uzrastima. Koeficijenti heritabilileta su se menjali za pojedine osobine i iznosili su od 0,13 do 0,60. Koeficijenti genetskih korelacija između mase i pojedinih telesnih dimenzija, kao i između eksterijernih mera su bili pozitivni i uglavnom su varirali od slabe do jake i potpune korelacione veze (rs = 0,294 do rs = 0,929) u zavisnosti od uzrasta.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PRIMENA GENETIČKE MUŠKE STERILNOSTI U SELEKCIJI SOJE

 

LJ. PRIJIĆ 1, Mirjana JOVANOVIĆ 1 i M. MLADENOVIĆ 2

 

1 Institut za kukuruz "Zemun Polje", Beograd-Zemun

2 Poljoprivredni fakultet, Beograd-Zemun

 

Izvođenje većeg broja ukrštanja kod soje je otežano pošto se i sa izvežbanim radnicima dobija nekoliko zrna po ukrštanju. Specht i sar. (1985. Crop Sci. 25:717-718) su objavili SG1 sintetisanu populaciju sa mS2 genom muške sterilnosti, nastalu ukrštanjem 39 roditelja majki sa 4 roditelja oca, donora mS 2 gena. Za ovo istraživanje je korišćeno F2 seme muških fertilnih biljaka, dobijeno posle četiri slobodna ukrštanja u populaciji. Seme je posejano u izolaciji radi ispitivanja efikasnosti oprašivanja muški sterilnih biljaka uz pomoć pčela (Apis mellifera L.) u parceli sa kavezom i otvorenoj parceli. Muški fertilne F2 biljke iz populacije su individualno požnjevene i primenom pedigri metode selekcije su dobijene F5 homozigotne muški fertilne linije. Populacija sa genskom muškom sterilnošću je pokazala svoju vrednost u selekciji, po§to je obezbeđen veći broj F1 zrna prirodnim ukrštanjem (pčelama) a takođe su dobijene i linije koje su u testu prinosa pokazale superiornost nad standardima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KOMPONENTE VARIJABILNOSTI I HERITABILNOST ZA NEKE OSOBINE PLODA TREŠNJE

 

Vera RAKONJAC, T. ŽIVANOVIĆ i D. NIKOLIĆ

 

Poljoprivredni fakultet, Beograd-Zemun

 

Na osnovu dvogodišnjih rezultata proučavanja pet osobina ploda (dužina peteljke, visina ploda, širina ploda, masa ploda, masa koštice) kod 20 sejanaca trešnje izračunati su pokazatelji naslednosti. Metodom analize varijanse utvrđeno je da na varijabilnost svih proučavanih osobina vrlo značajno utiču genetički faktor, dok je značajan uticaj faktora spoljašnje sredine zapažen za visinu i širinu ploda i masu ploda i koštice. Najveća varijabilnost, koja je prikazana koeficijentom genetičke i fenotipske varijabilnosti, je zapažena u masi ploda (CVS = 19,5%; CVf = 22,0%), a najmanja varijabilnost zapažena je za širinu ploda (CVS = 5,6%; CVf = 7,3%). Heritabilnost je varirala od 58,0% (širina ploda) do 84,7% (dužina peteljke) što pokazuje da na ekspresiju navedenih osobina presudan uticaj ima nasledna osnova trešnje. Vrlo značajna, pozitivna, kako genetička tako i fenotipska korelacija izračunata je između širine i mase ploda (rg = 0,96**; rf = 0,93**) između visine i mase ploda (rg = 0,92**; rf = 0,90**), između širine ploda i mase koštice (rg = 0,98**; rf = 0,60**), i između visine ploda i mase koštice (rg = 0,81**; rf = 0,66**) i između visine i širine ploda (rg = 0,89**; rf = 0,83**). Dobijene vrednosti koeficijenata korelacije pokazuju da selekcija u pravcu povećanja dimenzija ploda rezultira istovremeno i povećanjem mase ploda. Rezultati ovih proučavanja trebalo bi da omoguće oplemenjivačima trešnje da pravilno sagledaju genetičku osnovu ispitivanih osobina i olakšaju rad pri njihovoj selekciji.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PROUČAVANJE GENETIČKE KONTROLE KVALITETA LIPIDA U ZRNU KUKURUZA

 

G. SARATLIĆ 1, K. KONSTANTINOV 2, I. VEREŠBARANJI 1, Snežana MLADENOVIĆ1, J. DUMANOVIĆ 1, B. KEREČKI 1

 

1 Institut za kukuruz "Zemun Polje", Beograd-Zemun
2 Institut za ratarstvo i povrtarstvo, Novi Sad

 

Rezervni lipidi u zrnu kukuruza su deponovani velikim delom u klici u obliku triglicerida. Stepen nezasićenosti zavisi od učešća viših masnih kiselina u strukturi molekula triglicerida. Dužina lanca, stepen nezasićenosti i položaj više masne kiseline u molekulu triglicerida su genetički delerminisani. U ovom radu su vršena ispitivanja dejstva rekurentne selekcije u dve visokouljne sintetičke populacije na sadržaj i sastav viših masnih kiselina u zrnu kukuruza sa različitim sadržajem ulja. Povećanje sadržaja ulja je praćeno promenom odnosa zasićenih i nezasićenih viših masnih kiselina u lipidima tkiva klice i endosperma. Sa povećanjem sadržaja ulja ukupni sadržaj nezasićenih viših masnih kliselina, oleinske (C181) i linolne (182) se ne menja, ali dolazi do promene njihovog odnosa. Sa povećanjem sadržaja ulja odnos C182/C181 se smanjuje dok se odnos zasićenih visih masnih kiselina, palmitinske (C160) i stearinske (C180) povećava. Utvrđene su razlike u sastavu viših masnih kiselina lipida klice i endosperma. Ovi rezultati su dobijeni u biljkama koje pripadaju različitim ciklusima selekcije per se. Biće prikazani rezultati efekta ukrštanja dve populacije i inbriding depresije na stepen nezasićenosti lipida u tkivu klice i endosperma kao i odnos sadržaja visih masnih kiselina i sadržaja proteina.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NAČIN NASLEĐIVANjA POVRŠINE LISTA KOD KUKURUZA (Zea mays L.)

 

P. SKLENAR, J. BOĆANSKI i Marija KRALJEVIĆ-BALALIĆ

 

Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Novi Sad

 

Cilj rada je bio da se utvrdi način nasleđivanja svojstava površina lista kod F1 hibrida kukuruza. Za analizu posmatranog svojstva odabrano je trinaest inbred linija: CM109, HI20, PLS61B, Mo17HtR, Kapio, W729C, A641, P165, F2, 250A, CM 105, LH-74, Mo17-23 i dve linije (CM109 x A6342Ht) i (Mo17Ht x Mo17-23). Odgovarajuća ukrštanja su bila izvršena 1990. godine, ogled je bio postavljen 1991. godine po slučajnom blok sistemu u tri ponavljanja na oglednom polju Instituta za ratarstvo i povrtarstvo u Novom Sadu na Rimskim Šančevima. Najveću srednju vrednost za posmatrano svojstvo imala je linija (CM 109 x A632Ht) x = 554,01 cm2, a najmanju inbred linija F2 x = 264,24 cm2. Među hibridnim kombinacijama najveću srednju vrednost posmatranog svojstva imala je kombinacija: LH74 x Mo17-23 x = 709,40 cm2, a najmanju kombinacija CM109 x PLS61B x = 541,94 cm2. Kao način nasleđivanja posmatranog svojstva kod svih hibridnih kombinacija utvrđena je superdominacija (pozitivan heterozis).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ČARNA - NOVA SORTA TREŠNJE

 

A. STANČEVIĆ i M. NIKOLIĆ

 

Institut "Srbija", Centar za voćarstvo i vinogradarstvo, Čačak

 

Rad na stvaranju novih sorti trešanja (Primus avium L.) u Centru za voćarstvo i vinogradarstvo u Čačku odvija se vec punih 35 godina. Stvoreno je preko 4.500 hibrida od kojih je 47 izdvojeno za uza proučavanja, odnosno svega 1,04%. Od odabranih elitnih i hibrida jedan (V/32) je priznat za sortu i dobio ime "ČARNA" po boji ploda i mestu gde je nastala. Trešnja čarna stvorena je metodom planske usmerene hibridizacije u 1975. godini ukrštanjem sorti Majova rana i Schrecen Bigarreau uz obaveznu emaskulaciiu prašnika. Srednje je rana trešnja, sazreva sredinom juna uporedo sa sortom Van. Oblika je zarubljeno-srcastog sa slabo izraženom brazdicom. Pokožica je tanka, gipka, sjajna i glatka, tamnocrvene boje. Meso ploda je čvrsto, hrskavo i sočno, rubin-crveno, odličnog ukusa i arome. I sok je intenzivno crveno obojen, pa je ova sorta odličan bojadiser za sokove drugih voćnih vrsta i u konditorskoj industriji. Pogodna je za svezu potrošnju, a takođe i za raznovrsnu preradu. Vrlo je rodna i otporna na pucanje plodova od kiše.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IN VITRO KLIJANJE I ČUVANJE POLENA KUPINE

 

M. STANISAVLJEVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija" Beograd, Centar za voćarstvo i vinogradarstvo, Čačak

 

U postupku stvaranja novih sorti kupine (Rubus fruticosus L.) putem hibridizacije javljaju se problemi da se cvetanje nekih sorti koje se koriste kao roditeljski parovi ne poklapa. To se najizrazitije ispoljava između sorti sa bodljama i sorti bez bodlji. Iz navedenog proizilazi potreba da se ispita mogućnost čuvanja polena sorti kupine putem dubokog zamrzavanja radi korišćenja u narednoj godini. Za ispitivanje mogućnosti čuvanja polena kupine korišćena je sorta sa bodljama DAROW i sorte bez bodlji: BLACK SATIN, DIRKSEN THORNLEES, HIBRID 126-RA8, SMOOTHSTEM i THORNFREE. Cvetovi su skupljani neposredno pored otvaranja kruničnih listica u poljskim uslovima. Antere su vađene korišćenjem skalpela i stavljane u petri šolje na sušenje u uslovima sobne temperature 36 časova. Ispitivanje % klijavosti svežeg polena vršeno je naklijavanjem u visećoj kapi 12% i 16% saharoze, a posle 3 časa pomoću mikroskopa evidentiran je broj klijavih polenovih zrna. čuvanje polena vršeno je u flakonima sa zapušačem na temperaturi od -18 do 20 °C. Istovremeno deo uzoraka polena čuvan je na sobnoj temperaturi. Posle jedne godine ponovo je vršeno naklijavanje polena kako je navedeno u prethodnom postupku. Klijavost polena u 12% saharozi odmah posle vađenja antera i sušenja kretala se od 20,91% u sorte DIRKSEN do 49,20% u sorte SMOOTHSTEM, dok u 16% saharoze od 18,51% do 43,04% za iste sorte. Prosečna klijavost za sve sorte bila je veca u 12% rastvoru (34,10%) u odnosu na 16% rastvor saharoze (30,05%). Klijavost polena posle čuvanja u 12% rastvoru saharoze kretala se od 5,01% u sorte DARROW do 4,100% u sorte SMOOTHSTEM, dok je u 16% rastvoru od 4,03% do 42,30% za iste sorte. Prosečna klijavost polena bila je neznatno veća u 16% rastvoru saharoze (26,56%) u odnosu na 12% rastvor (25,90%). Ako se uporedi klijavost svežeg polena ispitivanih sorti kupine i polena čuvanog 1 godinu u uslovima dubokog zamrzavanja, zapaža se da klijavost opada u 12% rastvoru saharoze za 8,20% dok u 16% rastvoru opada za 3,49%. Iz navedenih podataka može se zaključiti da se polen može uspešno čuvati u datim uslovima, a da ne izgubi klijavost u većoj meri do naredne vegetacije kada se može upotrebiti u procesu hibridizacije.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UPOZNAVANJE GENETSKE SLIČNOSTI GEOGRAFSKI IZOLOVANIH POPULACIJA OMORIKE NA OSNOVU TERPENSKOG SASTAVA ISPARLJIVOG ULJA ČETINA


Tatjana STEVANOVIĆ JANEŽIĆ i V. ISAJEV

Šumarski fakultet Univerziteta u Beogradu, Beograd

 

Sekundarni metaboliti čctinara, kakvi su polifenoli, alkaloidi ili terpeni, sa ograničenom rasprostranjenošću u prirodi, analizirani su u cilju utvrđivanja genetske sličnosti izolovanih populacija i u hemotaksonomskim proučavanjima. Koncept korišćenja hemijskog sastava biljaka kao ne/avisnog biohemijskog svojstva zasniva se na činjenici da je biosinteza većine sekundarnih metabolita genetski kontrolisana na isti način kako je to slučaj sa morfološkim i citološkim karakleristikama. Analizom terpenskog sastava isparaljivih ulja četina test stabala omorike iz više populacija u Evropi utvrđen je stepen genetske kontrole sinteze sekundarnih metabolita. Stabla sa kojih su sakupljeni uzorci četina su iz populacija sa šireg autohtonog staništa omorike, iz Arboretuma Šumarskog fakulteta i iz Arboretuma Instituta za šumarsku genetiku pri BFH u Hamburgu. Etarski rastvor isparljivog ulja četina je analiziran gasno-tečnom hromatografijom GLC na Perkin-Elmer Sigma 2B gasnom hromotografu sa plameno-jonizacionim detektorom i Shimadzu L-RIB sistemom za obradu podataka. Identifikacija pojedinačnih pikova na hromatogramima izvršena je korištenjem autentičnih terpenskih jedinjenja. Na osnovu sastava monoterpenskih ugljovodonika, kao i njihovih oksidovanih derivata (alkohola, estara i ketona) utvrđen je isti terpenski uzorak za isparljiva ulja četina omorike sa svih ispitivanih lokaliteta: bornil acetat kao dominantna komponenta, pa po opadajucoj koncentraciji, ct-terpineol, limonen/β-felandren, kamfen, ά-pinen, mireen, citronclol, santen i triciklen. Na osnovu visokog stepena sličnosti terpenskih uzoraka isparljivih ulja četina omorike sa više geografski udaljenih lokaliteta može se zaključiti da je biosinteza ovih sekundarnih metabolita pod znatnom genetskom kontrolom.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

ANALIZA KOMBINACIONIH SPOSOBNOSTI ZA PRINOS ZRNA KUKURUZA (Zea mays L.)

 

M. STOJAKOVIĆ, D. JOCKOVIĆ, J. BOĆANSKI, G. BEKAVAC i R. POPOV

 

Institut za ratarstvo i povrtarstvo, Poljoprivredni fakultet, Novi Sad

 

Ispitivane su kombinacione sposobnosti linija i hibrida kukuruza u cilju stvaranja visoko-rodnih hibrida, pune vegetacije grupe zrenja FAO-600, pogodnih za gajenje u ravničarskim reonima Jugoslavije. Kao majčinske komponente korišćene su linije nastale ukrštanjem linije B-84 sa srodnim linijama iz BSS populacije. Za testere korišćena su tri linije (jedna linija je poreklom iz Lancaster populacije, a ostale dve su nastale ukrštanjem domaća x Lancaster plazma. Ogledi sa linijama i hibridima izvedeni su u Srbobranu i Novom Sadu u 1993. godini po slučajnom blok sistemu. Kombinacione sposobnosti ispitivane su metodom linija x tester. Na oba lokaliteta najbolji opšti kombinator za prinos zrna bila je linija NS L-8, zatim NS L-5 i NS L-4, a najlošiji opšti kombinator bile su linije NS L-l i NS L-2. Tester NS L-9 u Srbobranu je imao visokosignifikantno pozitivne vrednosti OKS za prinos zrna, dok su tester NS L-10 i NS L-ll imali negativne vrednosti OKS. Najbolji opšti kombinator u Novom Sadu bio je tester NS L-10. Između hibrida ustanovljene su značajne razlike u efektima PKS za prinos zrna kukuruza. Najbolji kombinator u Srbobranu bile su linije NS L-9x NS L-l, a u Novom Sadu NS L-3 x NS L-9, dok su najslabije PKS imali hibridi NS L-l x NS L-10 i NS L-4 x NS L-10. Za prinos zrna kukuruza dominantna komponenta genotipske varijanse značajnija je od aditivne komponente genotipske varijanse.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NAČIN NASLEĐIVANjA VISINE BILJAKA UKRASNIH SUNCOKRETA

 

Vidosava ŠEĆEROV-FIŠER

 

Poljoprivredni fakultet, Beograd-Zemun

 

Visina biljaka je vrlo značajna osobina ukrasnih suncokreta. U dialelnim ukrštanjima pet inbred linija ukrasnih suncokreta ispitivan je način nasleđivanja, kombinirajuće sposobnosti i komponente genetske varijabilnosti za visinu biljaka u F1 i F2 generaciji. Između ispitivanih inbred linija postoje značajne razlike u visini biljaka. Visina biljaka se u F1 i F2 generaciji nasleđuje dominantno ili superdominantno u zavisnosti od kombinacije. Analiza kombinirajućih sposobnosti ukazuje da nasleđivanje visine biljaka ukrasnih suncokreta zavisi od neaditivnog delovanja gena.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PROCENA GERMPLAZME KOLEKCIJE Agrostis stolonifera MULTIVARIJACIONOM ANALIZOM

 

Gordana ŠURLAN-MOMIROVIĆ, Zorica TOMIĆ 1, Ivana RALEVIĆ i N. RALEVIĆ

 

Poljoprivredni fakultet, Univerzitet u Beogradu, Beograd-Zemun
1 Institut za istraživanja u poljoprivredi "Srbija" - Beograd, Centar za krmno bilje, Kruševac

 

U ovom radu kolekcionisano je 35 autohtonih populacija vrste Agrostis stolonifera L. sa užeg područja Srbije i analizirane su metodama jednovariacione i multivariacione statističke analize. Sakupljene su biljke sa različitih prirodnih staništa: dolinskih livada - 22 populacije, brdskih livada - 7 populacija i planinskih livada i pašnjaka - 7 populacija. Pedeset semena svake populacije je naklijano u Petri kutijama u jesen 1991 i posle izvesnog vremena posejano u polju. Populacije vrste A stolonifera L. su predstavljene sa tri nivoa poliploidnosti: diploidna, tetraploidna i heksaploidna. Proučen je uticaj 11 najvažnijih osobina vrste A. stolonifera L. na razdvajanje 35 populacija. Posmatrane osobine praćene su na pojedinačnim biljkama u 1992. i 1993. godini. Rezultati klasifikacije dobijene na osnovu linearnih diskriminacionih funkcija pokazuju da postoji mala razlika između stvarnih i ocenjenih grupa. Cilj ovih istraživanja je bio da se klasifikuje na§a kolekcija populacija vrste A stolonifera L. pomoću multivariacione analize primenjene na grupu kvantitativnih osobina kao što su morfo-fiziološke i agronomske sa praktičnim značajem u procesu oplemenjivanja tih trava.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

OPLEMENJIVANJE ITALIJANSKOG LJULJA (Lolium multiflorum Lam.) UDVAJANJEM HROMOZOMA

 

Zorica TOMIĆ

Institut za istraživanja u poljoprivredi "Srbija" - Beograd, Centar za krmno bilje,

Kruševac

 

Italijanski ljulj (Lolium multiflorum Lam.) je vrlo značajna trava visoke produkcije i dobrog kvaliteta krme. Stvaranjem novih sorti ova svojstva se mogu poboljšati. U ovom radu je prikazan metod dobijanja nove tetraploidne sorte italijanskog ljulja koja ima bolji kvalitet i prinos sena od domac"c sorte K-13. Prikazani su rezultati izdvajanja tetraploidnih porodica koje su dobijene udvajanjem hromozomskog broja. Iz tih porodica stvorena je nova sorta tetraploidnog ljulja. Istraživanja su započeta 1980. godine, tako što su 200 naklijalih semena domaćih diploidnih sorti tretirane 0,2% kolhicinom u tajanju od 2 sata da bi se dobile tetraploidne biljke. Biljke su rasađene na oglednom polju, a u toku vegetacionog perioda praćene su neke morfološke osobine i izmerena je produkcija suve mase. Takođe je obavljena žetva semena. Izbor biljaka određen je citogenetičkom analizom određivanja broja hromozoma. Za dalji rad uzimane su samo biljke koje su imale tetraploidan broj hromozoma 2n=4x=28. Homozigotnost takvih biljaka postignuta je samooplodnjom tih biljaka u toku Scsi generacija. Dobijeno je sedam porodica iz sorte B-9, tri iz sorte Jabeljska i dve iz sorte K-13 u C6 generaciji. Biljke iz ovih porodica bile su majčinske komponente koje su u sistemu polikrosa dale novu sortu. Ta nova sorta je testirana u mreži sortnih mikroogleda tokom 1990-1992. godine u: Ljubljani, Banja Luci, Novom Sadu i Kruševcu. Za testiranje produkcije i kvaliteta nove sorte kao standard služila je domaća sorta K-13. U odnosu na nju nova tetraploidna sorta italijanskog ljulja pokazala je znatno viši prinos sena (15.501 kg/ha) i sadržaj proteina (2.328 kg/ha).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOSTI NASLEDNOST MORFOLOŠKIH PARAMETARA LISTA KLONOVA TOPOLA SEKCIJE LEUCE

 

Z. TOMOVIĆ i S. ORLOVIĆ

 

I.R.C. Javno preduzeće "SRBIJAŠUME", Beograd; Naučni institut za topolarstvo, Novi Sad

 

Istraživanjima varijabilnosti naslednosti morfoloških parametara lista topola sekcije LEUCE obuhvaćeno je deset klonova sledeće taksonomske pripadnosti: Populus alba, P. alba, f. boleana, P. tomentosa, P. Alba x P. grandidentala i P. tremula cv. Astria. Na uzorcima lišća iz rasadničkog ogleda merene su veličine i broj sledećih parametara: dužina lista duž glavnog nerva (XI), najveća širina lista (X2),dužina od vrha lista od mesta najveće širine (X3), dužina lisne peteljke (X4), broj nerava (X5), ugao između donjeg para bočnih nerava (X6), odstupanje baze lista od zamišljene ravne osnove lista (X7), najveća dubina režnja na obodu lista (X8), i broj režnjeva (X9). Pored navedenih parametara izračunati su i odnosi sledećih parametara:

 

X2        X3        X4

X1        X1        X1

 

Rezultati istraživanja su pokazali da između klonova (genotipova) postoje statistički vrlo značajne razlike u pogledu veličine i broja istraživanja parametara lista. Pored toga dobijene su vrlo visoke vrednosti koeficijenata naslednosti u širem smislu (h/bs). Ukupni rezultati su jasno pokazali da se istraživani parametri veličine i oblika lista mogu koristiti kao pouzdani pokazatelji za makroskopsku determinaciju klonova u eksperimentalnoj i redovnoj rasadničkoj proizvodnji.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ NIVOA GENA HOLŠTAJN-FRIZIJSKE RASE NA OSOBINE MLEČNOSTI I PLODNOSTI KRAVA CRNO-BELIH GOVEDA

 

G. TRIFUNOVIĆ 1. LJ. LAZAREVIĆ 1, D. LATINOVIĆ 1, P. STOJIĆ 2 i M.

KATIĆ 2

 

1 Poljoprivredni fakultet, Beograd-Zemun

2 Agroekonomik, Beograd

 

Ispitivanje uticaja gena holštajn-frizijske rase na osobine mlečnosti prve tri cele i standardne laktacije, kao i na reproduktivne osobine posle prva tri telenja populacije krava crno-belih goveda obavljeno je na PK "Beograd". Analizom je obuhvaćeno 730 laktacija, odnosno telenja. Sa prvom laktacijom u ispitivanja je uključeno 309 grla, drugom 236 i trećem 185. U zavisnosti od udela gena holštajna sve krave su raspoređene u 3 grupe (klase: 1 0-24; II 24-39 i III 39-100). Podaci su obrađeni primenom metoda najmanjih kvadrata. Trajanje laktacije u proseku je iznosilo 324,3 dana. S obzirom da se trajanje cele laktacije nije mnogo razlikovalo od standardne to ćemo navesti samo vrednosti osobina mlečnosti cele laktacije posmatrano po grupama holštajn-frizijskih gena: prinos mleka 5932,1 kg (I), 5960,9 kg (II) i 6291,6 kg (III); prinos mlečne masti od 220,3 kg (I) do 232,2 kg (III); prinos 4% mast korigovanog mleka (MKM) 5677,7 (I), 5693,0 (II) i 6000,0 (III grupa). Kod navedenih osobina ispoljene su statistički visoko signifikantne razlike (P <0,01) posmatrano po grupama holštajn-frizijskih gena, za razliku od sadržaja mlečne masti gde su vrednosti bile vrlo ujednačene, a značajnost nije bila signifikantna (P >0,05). Analiziranjem ustanovljenih vrednosti reproduktivnih osobina (indeks osemenjavanja, interval od telenja do prvog osemenjavanja, međutelidbeni interval i telesna masa teladi) posmatrano u odnosu na različit nivo zastupljenosti gena holštajn-frizijske rase nisu se ni kod jedne osobine ispoljile statistički signifikantne razlike (P >0,05).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

SELEKCIONI PROGRES I DIVERGENTNOST DOMAĆIH SINTETIČKIH POPULACIJA KUKURUZA (Zea mays L.)

 

B. TRIFUNOVIĆ, V. TRIFUNOVIĆ, Gordana RADOVIĆ i D. JELOVAC

 

Institut za kukuruz "Zemun Polje", Beograd-Zemun

 

Cilj ovog rada je bio da utvrdi da li je došlo do selekcinog progresa za prinos i druga agronomska svojstva kao i održavanje divergentnosti selekcionog materijala kukuruza sintetizovanog od linija: a) domaćeg porekla (IV, IRu, IVuRu: MRI "ZP") i b) domaćeg porekla x egzotična germplazama (MRI/USA, IVu/USA). Signifikantno povećanje prinosa, kao posledica akumulacije poželjih alela utvrđeno je kod sintetičkih populacija domaćeg porekla, kao i njihovih test-cross-eva. Unošenje egzotične germplazme, znatno je uticalo na nivo promena u pozitivnom pravcu, naročito za svojstva sadržaja vlage i stabilnosti biljke kukuruza. Analiza glavnih komponenti (PCA) ukazuje da se sintetici, njihove kombinacije i standard! prostorno raspoređuju u dve difcrencirane grupe. Prva glavna komponenta je definisanje prinosom, pa na osnovu toga zaključujemo da se najveći heterotični efekat ispoljava u kombinaciji sintetika ili njihovih kombinacija sa Lancaster plazmom (osim u slučaju sintetika IVv/USA). Kombinacija sa SSS-om dovodi do manjeg nivoa heterozisa, osim kod sintetika MRI/USA. Ovaj sintetik pokazuje dobru kombinacionu sposobnost i sa Lancaster i SSS plazmom. Poreklo sintetika MRI "ZP" je iz rekombinacije linija koje su formirale sintetike IVu i IRu, dok je sintetik MRI/USA nastao rekombinacijom linija iz sintetika MRI "ZP" sa linijom B37. Ovo nas navodi na zaključak da je rekombinacijom početnog materijala genetička osnova ovog sintetika šira nego u pojedinačnim sinteticima IVu ili IRu, ili njegovoj kombinaciji IVuIRu. Visoka kombinaciona vrednost kod obe sintetizovane germplazme, sa svetski poznatim testerima (Lancaster i SSS), ukazuje da je ovaj selekcioni materijal zadržao svoju divergentnost. Dobijeni rezultati ukazuju da su novi izvori germplazme kukuruza podesni za stvaranje poboljšanih hibridnih kombinacija, izborom odgovarajućeg selekcionog postupka.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POLIPLOIDNI KOMPLEKSI, DIPLOIDIZACIJA POLIPLOIDA I OPLEMENJIVANJE DRVEĆA I ŽBUNjA

 

A. TUCAKOVIĆ i V. ISAJEV

 

Šumarski fakultet, Beograd

 

Evolucioni potencijal poliploidnih kompleksa ima vaznu ulogu u procesu oplemenjivanja drveća i žbunja, zbog čega je u radu razmatran dijapazon hromosomskih brojeva drveća i zbunja, nivo poliploidnosti, rasprostranjenje poliploiodije, osnovni brojevi hromosoma i proces diploidizacije poliploida drveća i žbunja. Značaj poliploidije u rekonstrukciji drvenastih vrsta ilustrovano je na primeru oplemenjivanja ruža, a opšti metodski pristup zasniva se na činjenicama: a) znatan broj vrsta (15,1%) drveća i žbunja su poliploidi, b) pojedine vrste drveća postižu visok stepen plidnosti, c) poliploidija stabilizuje heterozigotnost i smanjuje sposobnost prevođenja potencijalne u slobodnu promenljivost i d) zavisnost neravnomerne rasprostranjenosti poliploidije od strukture hromosoma, načina razmnožavanja, klimata i drugih faktora. Rasprostranjenost poliploidije kod drveća i žbunja javlja se neujednačeno u različitim taksonomskim grupama, što je u radu ilustrovano primerima kod deset familija drveća i žbunja: Belulaceae, Budleiaceae, Caprifoliacea, Fabaceae, Hippocastanaceae, Magnoliacceae, Moraceae, Rosaceae, Tiliaceae, Agavaceae. Usvajajući n=6 do 9 za najverovatniju vrednost osnovnog broja hromozoma, drveće i žbunje sa n=10 do n=21 spada u grupu sekundarnih-drvenih diploida. Putem diploidizacije, drveni polipoidi stiču svojstva primarnih diploida što čini osnovu za dalje oplemenjivanje. Jedan deo poliploida u prirodi pripada aloploidima koji omogućuju prevazilaženje barijera hibndne sterilnosti, omogućuju reprodukciju hibrida u čistim oblicima, obezbeđuju stabilnost visokoheterozigotnih genotipova, svojstva heterozisa i fiziološkog homeostazisa u hibridnim kombinacijama.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOST POLA I NJEN ZNAČAJ ZA OPLEMENJIVANJE  DOMAĆE CRNE TOPOLE (Populus nigra L.)

 

A. TUCOVIĆ, V. ISAJEV i Mirjana ŠIJAČIĆ

 

Šumarski fakultet, Beograd

 

Kod domaće crne topole, koja je dvodoma vrsta, evidentirano je više tipova varijabilnosti pola: na klonu Populus nigra var. thevestina pojava dvopolnih cvetova, na stablima domaće crne topole u Poibarju, pojava monoecije i pojava poligamije na jednom stablu sa razgranatim u osnovi muškim cvastima. Analiza prirode uočene ekstremne promenljivosti pola obavljena je, za monoecijsko stablo putem poljskog ogleda i odgajivanjem samooplodnog potomstva, a kod stabla sa dvopolnim cvetovima i razgranatim poligamnim cvastima sa stacionarnim opažanjima. Autofekondacija i odgajivanje samooplodnog potomstva obavljeno je metodom ablaktacije fertilnih grana monoecijskog stabla uz pomoć suda sa vodom na dvogodišnjim generativnim podlogama gajenim u saksijama. Rezultati analiza matičnih stabala i kalema jednodomog stabla, dokazuju da su analizirana svojstva abnormalnosti u gradi reproduktivnih organa domaće crne topole genetički kontrolisana. Ostvarena samooplodnja i odgajeno potomstvo, dopunjuje postojeće načine razmnožavanja crne topole, pored isključivo ksenogamije i čestog autovegetativnog razmnožavanja, što obogaćuje ontogenetsku i filogenetsku adaptaciju vrste kao i njeno dalje oplemenjivanje.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MASOVNA I INDIVIDUALNA SELEKCIJA MUNIKE (Pinus heldreichi Christ.) U SRBIJI

 

A. TUCOVIĆ, V. ISAJEV i Mirjana ŠIJAČIĆ

 

Šumarski fakultet, Beograd

 

Munika je tercijerni relikt i endemna vrsta koja se odlikuje velikim genetskim potencijalom. Primenom masovne i individualne selekcije započeto je u Srbiji sa oplemenjivanjem ove vrste. Objekt istraživanja su velike i male populacije u okviru njenog areala i više kultura. Analiza grupne i individualne fenotipske promenljivosti obavljena je uporedno morfološko-fiziološkiin ispitivanjima, stacionarnim fenološkim i drugim osmatranjima, slobodnim i asortativnim oprašivanjima, odsustvom oprašivanja, samooprašivanjem i međuvrsnom hibridizacijom sa oglednim stablima crnog bora. Navedenim istraživanjima je obuhvaćeno: 1. izučavanje prirode fenotipske varijabilnosti velikih i malih populacija, 2. uticaj tipa oprašivanja na unutrašnje osobine semena, 3. kvantifikacija mogućnosti hibridizacije stabala munike i crnog bora i 4. unapređenje tehnike masovne i individualne selekcije. Dobijeni rezultati potvrđuju prisustvo velike individualne i grupne varijabilnosti kod analiziranih svojstava kao i postojanje inkopatibilnsoti pri međuvrsnoj hibridizaciji munike i crnog bora. Evidentirana pojava viviparije usmerava buduća dopunska citološka, histološka i embriološka istraživanja. S obzirom na to da munika spada među vrste drveća sa skromnim zahtevima prema staništu, dobijeni rezultati potvrđuju podobnost munike za pošumljavanja vrlo siromašnih staništa. Osnovni pravci daljih istraživanja usmereni su na unapređenju i korišćenju semenskih sastojina munike u pojasu od 1400 do 1800 m n.v. manjih grupa od 600 do 1000 m i u osnovanim kulturama munike izvan prirodnog areala.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

RFLP U LOKUSIMA Glu-1I TEHNOLOŠKI KVALITET SORTI PŠENICE

 

Ljiljana VAPA, S. DENČIĆ 1, Erika RAKK-ŠOLTES 2 i S. KEVREŠAN

 

Prirodnomatematički fakultet, Novi Sad

1 Poljoprivredni fakullet, Novi Sad
2 Department of Botany, University of Toronto,Canada

 

Danas je poznato da visokomolarni glutenini, čiju sintezu kontrolišu geni lokusa Glu-1, utiču u velikoj meri na tehnološki kvalitet sorti pšenice. Cilj rada je bio da se ustanovi veza između RFLP i komponenti tehnološkog kvaliteta pšenice. Genomska DNK izolovana je iz klijavaca pšenice, i nakon digestije sa BamHI i Southern transfcra, fragmenti su hibridizovani sa probom pTag12909 za visokomolekulski gluteninski polipeptid. Komponente tehnološkog kvaliteta odrešene su standardnim metodama. Ustanovljeno je da fragment 10 kb potiče iz lokusa Glu-Al-1; fragment 3 kb iz Glu-Bl-1; fragmenti 2,7 kb, 2,8 kb i 2,9 kb iz Glu-Bl-2, fragment 11,5 kb iz Glu-D-1; a fragmetni 2,4 kb i 2,5 kb i iz Glu-D-1-2. Poreklo fragmenta 2,3 kb nije bilo mogućc utvrditi. Signifikanatne razlike nađene su u sedimentacionoj vrednosti, modi upijanja vode, izbrašnjavanja, farinološkom broju, zapremini hleba i vrednosnom broju sredine hleba, između sorti sa fragmentom 2,3 kb, u odnosu na sorte koje nisu posedovale taj fragment.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETSKA ANALIZA BROJA ZRNA PO BILJCI U UKRŠTANJIMA KOD BELIH PASULJA

 

MirjanaVASIĆ

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Novi Sad

 

Broj zrna po biljci je jedna od karakteristika kojom se biljka pasulja opisuje. Ta osobina je direktni proizvod broja mahuna po biljci i broja zrna po mahuni. Ove osobine većina naučnika koristi kao selekcione kriterijume. Sve tri osobine ispitivane su ukrštanjima linija iz populacija Gradištanca i Tetovca sa sortama Medijana, Biser i Oplenac. Linije iz populacija imaju indeterminantno stablo, sorte determinantno, a zrna su kod svih bcle boje. Analiza je rađena na pet roditeljskih populacija, šcst populacija F i i šcst populacija F 2 generacije. Kod roditelja najveći broj zrna i mahuna po biljci imao je Tetovac, pa Gradištanac, a najmanji Oplenac. Broj zrna po mahuni veći je kod ispitivanih sorata nego kod linija iz populacija. Varijabilnost broja mahuna po biljci je srednja do visoka i kod roditelja i kod hibrida. Broj zrna po mahuni je niske varijabilnosti. Kao način nasleđivanja u F1 se pojavljuje heterotični efekat ili dominacija roditelja sa većom srednjom vrednošću. Kod broja zrna po mahuni ima intermedijarnog načina nasleđivanja. Heterozis je najveći u broju zrna po biljci. U Fz dolazi do smanjenja srednjih vrednosti populaciju. Način nasleđivanja za broj zrna i broj mahuna po biljci je intermedijaran ili dominacija roditelja sa većom srednjom vrednošću. Broj zrna po mahuni se u F 2 nasleđivao najčešće dominacijom roditelja sa nizom srednjom vrednošću. U jednom slučaju se ispoljio i negativni heterozis. Heritabilnost broja mahuna i zrna po biljci i broja zrna po mahuni u većini kombinacija bila je visoka. Kod ispitivanih osobina u ukrštanjima sa Gradištancem pojavile su se biljke sa transgresijama. U ukrštanjima sa Tetovcem transgresija je bila samo u broju zrna po mahuni.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

"IN VITRO" SELEKCIJA SUNCOKRETA (Helianthus annuus L.) NA OTPORNOST PREMA Diaporthe (Phomopsis) helianthi Munt.-Cvet. i dr.

 

Dragana VASIĆ, Ana MARJANOVIĆ i B. DOZET

 

Poljoprivredni fakultet, Institut za ratarstvo i povrtarstvo, Zavod za uljne kulture, Novi Sad

 

Semena linija suncokreta CMS-V-8931-3-4 i Ha-74 su sterilisana i postavljena na B5 podlogu. Biljčice sa dobro razvijenim kotiledonima su prebačene na B5 podlogu u koju je dodat filtrat Phomopsis-a u različitim koncentracijama (0%, 25%, 50% i 75%). Nakon sedam dana, određivano je devet svojstava biljčica: visina, porast, boja hipokotila, broj formiranih listova, razvijenost korena, masa u svezem stanju, masa u suvom stanju, odnos masa u suvom i svezem stanju i anatomska grada stabla. Statistička analiza je pokazala da se porast i broj formiranih listova mogu koristiti kao indikatori otpornosti na Phomopsis, jer su, za ove osobine, postojale značajne razlike između dva ispitivanja genotipa. Otpornija linija, Ha-74, je imala veći porast i broj formiranih listova. Koncentracija filtrata od 50% je bila optimalna za utvrđivanje otpornosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOST MAKROSKOPSKIH I MIKROSKOPSKIH KARAKTERISTIKA DVOGODIŠNJIH SADNICA 26 HALF SIB FAMILIJA PLANINSKOG JAVORA (Acer heldreichii Orph.)

 

Dragica VILOTIĆ, Mirjana ŠIJAČIĆ i V. ISAJEV

 

Šumarski fakultet, Beograd

 

Planinski javor, kao i većina endema reliktnih vrsta, se odlikuje velikim genetskim potencijalom usled čega ima poseban značaj pri osnivanju kulturnih zajednica na staništima visokoplaninskih regiona. Od sakupljenog semena 26 test stabala iz prirodnih populacija na Goliji, u rasadniku u Ivanjici, standardnim metodama odgajene su half sib familije po blok sistemu. Kod dvogodišnjih sadnica mereno je više makroskopskih i mikroskopskih karakteristika: visina i prečnik u korenovom vratu i mikroskopskih osobina: širina sprovodnih sudova, visina i širina trake lignuma i broj sprovođenih sudova i traka lignuma po jedinici površine. Ovi karakteri sadnica su izabrani jer se mogu smatrati veoma značajnim za dinamiku rasta biljaka u juvenilnom stadijumu razvića. Dobijeni rezultati obavljenih morfometrijskih analiza na uzorku od 15 sadnica po familiji, pokazali su postojanje znatne međufamilijarne promenljivosti srednjih vrednosti i drugih statističkih parametara kod svih analiziranih svojstava: za visine od 37,9 do 97,7 cm, prečnika u korenovom vratu od 0,73 do 1,01 cm, prečnika traheja 18,6 do 47,7 mikrometara, visine traka lignuma do 32 c"clije, širine traka lignuma 1 do 4 delije. Rezultati linearnih korelacija pokazali su kod većine svojstava visok stepen zavisnosti. Dinamika rasta 1. i 2. godišnjih sadnica, kao i njihpva otpornost na stres presadnje u znatnoj meri su uslovljeni karakterom analiziranih svojstava. Iz ovih razloga kod semena stabala sa ekstremnim familijama, u narednim godinama uroda, treba utvrditi stepen nasledljivosti poželjnih makro i mikroskopskih svojstava, nakon čega ih treba uključiti u masovnu proizvodnju sadnica sa željenim osobinama.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NASLEĐIVANjE DEBLJINE PERIKARPA PLODOVA PARADAJZA (Lycopersicon escukntum Mill.)

 

Jasmina ZDRAVKOVIĆ, Z. MARKOVIĆ, M. DAMJANOVIĆ i M. ZDRAVKOVIĆ

 

U dialelnoj analizi 6 roditeljskih genotipova paradajza, signifikantno različitih za debljinu perikarpa, ispitano je nasleđivanje ove osobine u 15 hibrida F1 i F2 generacije. Debljina perikarpa u F1 generaciji nasleđivala se dominantno (sa pojavom superdominacije). U F i generaciji pet hibrida ispoljio se heterozis, kod dve dominacije roditelja sa većom vrednošću debljine perikarpa i u dve kombinacije intermedijarno nasleđivanje. U F2 generaciji heterozis se javio u dva hibrida, u tri dominacija roditelja sa većom vrednošću debljine perikarapa i u četiri kombinacije intermedijarno nasleđivanje. Rezultati kombinacionih sposobnosti u F1 i F2 generaciji ukazuju da u nasleđivanju ove osobine učestvuju geni sa neaditivnim i aditivnim efektom. U F1 generaciji preovlađujući uticaj imaju aditivni geni (OKS >PKS).

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA ANALIZA PRODUKTIVNOG BOKORENJA KOD PŠENICE

 

Veselinka ZEČEVIĆ, M. PAVLOVIĆ, D. KNEŽEVIĆ i B. VULIĆ

 

Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita "Kragujevac", Kragujevac

 

U dialelnom ukrštanju (bez recipročnog) četiri divergentne sorte pšenice (Srbijanka, Partizanka, KG-56 i PKB-111) ispitivanje način nasleđivanja, efekti gena i kombinacione sposobnosti za produktivno bokorenje. Ispitivanja su izvršena na biljkama F2 generacije. Analiza komponenti genetičke varijanse je urađena po metodi Hayman (1954) i Jinks (1954), a regresiona analiza po metodi Mather & Jinks (1971), dok su kombinacione sposobnosti urađene po metodi Griffing (1956), metod 2, model I. Na osnovu dobijenih rezultata može se zaključiti da je način nasleđivanja produktivnog bokorenja bio različit (parcijalna dominacija, dominacija i superdominacija) i zavisio je od kombinacije ukrštanja. Analiza komponenti genetičke varijanse ukazuje da su dominantni genetički efekti za nasleđivanje ovog svojstva značajniji u odnosu na aditive. Frekvencija dominantnih alela je veća od frekvencije recesivnih. Prose&m stepen dominacije je veci od jedinice, što ukazuje da se radi o superdominaciji uzevši u obzir sve kombinacije ukrštanja. Regresiona analiza ukazuje na dominantni tip nasleđivanja (superdominacija), pri čemu su roditelji bili divergentni u pogledu rasporeda dominantnih i recesivnih alela. Analiza varijanse kombinacionih sposobnosti pokazuje veći udeo neaditivnih genetičkih efekata, pri čemu je OKS/PKS manji od jedinice. Od ispitivanih sorti najbolji opšti kombinator za produktivno bokorenje je Partizanka, a najveću vrednost PKS imala je kombinacija Srbijanka x PKB-111.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IZOZIMSKA VARIJABILNOST U JUGOSLOVENSKIM KOLEKCIJAMA KUKURUZA

 

Marija ZLOKOLICA i I. GERIĆ

Institut za ratarstvo i povrtarstvo, Novi Sad

 

Izozimska varijabilnost enzimskih sistema analizirana je u polupopulacijama jugoslovenskih kolekcija kukuruza. Izozimi su korišćeni kao molekularni markeri za utvrđivanje varijabilnosti između populacija. Analiziranje izozimska varijabilnost za 12 enzimskih sistema i kontrola za 21 genetski lokus. Ispitivane populacije su se razlikovale unutar i između klasifikacionih grupa kojim su pripadale. Genetska udaljenost između analiziranih populacija bila je veća ili manja. Utvrđeni su odnosi između varijabilnosti i genetske udaljenosti. većina populacija sa visokom unutar populacionom varijabilnošću bile su i genetski udaljene. Rezultati pokazuju da populacije sa niskom unutar populacionom varijabilnošću su po pravilu genetski bliže. Ova ispitivanja pojedinih kolekcija kukuruza imaju značaj za selekciona istraživanja.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NUMERIČKA KLASIFIKACIJA ZPSin POPULACIJA KUKURUZA BAZIRANIH NA KVANTITATIVNIM OSOBINAMA

 

T. ŽIVANOVIĆ, Gordana ŠURLAN-MOMIROVIĆ, Ivana RALEVIĆ i N. RALEVIĆ

 

Poljoprivredni fakultet, Beograd-Zemun

 

Izvršena je klasifikacija 28 populacija kukuruza kolekcije germplazme Zemun Polje, na osnovu 16 morfoloških osobina na tri lokaliteta. Proučavane su osobine klipa, morfološko-vegetativne i fiziološko-adaptivne osobine biljke. Analizirane su osobine pojedinačnih biljaka pomoću multivarijacione statističke metode (Kanonska analiza). Slične populacije su grupisane u četiri grupe prema analizi Euklidove distance. Proučavane morfološke i fiziološke osobine pokazivale su varijabilnost. Dobijeni rezultati ukazuju na precizno razdvajanje na klastere dobijene numeričkom metodom i procenom kolekcije germplazme kukuruza. Proučavanje velikog broja kvantitativnih osobina je važno za oplemenjivanje izvora germplazme, što ukazuje da neke osobine mogu poslužiti za procenu relativnog doprinosa ukupne različitosti i grupisanja u slične populacije što se može iskoristiti u oplemenjivačkom radu kukuruza.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POPULACIONA GENETIKA I DVE VELIKE SINTEZE MODERNE BIOLOGIJE

 

N. TUCIĆ

 

Biološki fakultet i Laboratorija za evolucionu biologiju, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Osnovni zadatak savremene populacione genetike jeste opisivanje i predviđanje promena genetičke i fenotipske strukture populacija pod delovanjem različitih evolucionih mehanizama kao što su sistemi ukrštanja, selekcija, genetički drift, mutacije, protok gena i rekombinacije. Srž savremene verzije Darvinove evolucione teorije jeste populaciona genetika. Poslednjih godina neke elemente moderne evolucione sinteze oštro osporavaju paleontolozi i molekularni biolozi. U ovom referatu ja 6u iz perspektive populacione genetike razmatrati neke savremene teme evolucione teorije kao što su mehanizmi postanka vrsta, mobilni genetički elementi i hromozomski rearanžmani u evoluciji, regulatorni geni i evolucione novine, da ljudi pri tome dokaze kojima se negiraju tvrdnje da "sintetička teorija" nije više valjana. Druga velika sinteza u biologiji ovog veka jeste sociobiologija. Opet, populaciona genetika je jedan od značajnih konstituenata te nove sinteze. Počevši od Vilsona, savremeni sociobiolozi nude genetička objašnjenja za takve kulturološke manifcstacije kao §to su etika, religija, tribalizam, patriotizam, ratni sukobi, genocid, konformizam, podložnost indoktrinaciji itd. Mada je u onome što nudi sociobiologija kao "objašnjenje ljudske prirode" malo novog i drugačije od klasičnog biološkog determinizma, čini se da je sasvim primereno da se i ovom prilikom pažljivo analiziraju ideje koje se iznose u sociobiologiji, posebno zbog troga što te ideje u poslednje vreme nailaze na široku i nekritičku pažnju u našem društvu.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKE KOMPONENTE VARIJABILNOST I VELIČINE I OBLIKA TOKOM ONTOGENIJE KOD GUŠTERA Lacerta oxycephala

 

I. ALEKSIĆ

 

Laboratorija za evolucionu biologiju, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Gušteri se veoma često koriste za testiranje različitih hipoteza koje se odnose na adaptacije i postanak vrsta na morfološkom nivou. Međutim, uprkos činjenici da je znanje o genetičkoj varijabilnosti veličine i oblika morfoloških osobina od suštinskog značaja za potpunije evolucione analize, informacija koja se odnosi na kvantitativno-genetičku varijabilnost tih osobina praktično i nema za populacije guštera. U ovom radu date su procene komponenti fenotipske varijanse i kovarijanse između sedam metričnih osobina koje su dobijene analizama rođenih braće i sestara novorođenih guštera vrste Lacerta oxycephala. Takođe, ovde smo pokušali da utvrdimo i promene tih komponenti tokom prvih 90 dana rasta guštera pod laboratorijskim uslovima.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KVANTITATIVNA GENETIKA JUVENILNIH OSOBINA KOD Iris pumila STRUKTURA FENOTIPSKE VARIJABILNOST

 

S. AVRAMOV i Branka TUCIĆ

 

Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Zbog visoke slope mortaliteta tokom klijanja i uspostavljanja klijanaca, period ranog razvića se smatra za najkritičniju fazu životnog ciklusa mnogih vrsta biljaka. Takođe se često naglašava da je delovanje prirodne selekcije na biljke u juvenilnom stadijumu životnog ciklusa veoma intenzivna. Ako je prirodna selekcija zaista snažan evolucioni faktor u ranim stupnjevima razvić"a biljaka, tada se teorijski očekuje niska aditivna varijansa osobina koje su visoko korelisane sa adaptivnom vrednošću i koje se nalaze pod delovanjem direkcione selekcije. Da bi testirali ovu hipotezu mi smo utvrdili strukturu fenotipske varijabilnosti veličine semena i nekoliko osobina-komponenti adaptivne vrednosti u jednoj populaciji 7m pumila sa ciljem da se otkriju uzroci difernecijalne performanse klijanaca. Korišćenjem specifičnog ukrštanja u srodstvu (engl. paternal half-sib crossing design) bili smo u mogućnosti da procenimo veličinu genetičkih i sredinskih efekata na fenotipsku varijabilnost odabranih kvantitativnih osobina. Prisustvo aditivne genetičke varijanse nije bilo utvrđeno ni za jednu od ispitivanih osobina. Međutim, neaditivna i materinska komponenta varijanse bile su statistički značajne za većinu osobina, posebno onih ispoljenih tokom prvih deset dana životnog ciklusa L pumila. Ovi rezultati potvrđuju teorijska predviđanja o smanjenoj aditivnoj genetičkoj varijansi osobina korelisanih sa adaptivnom vrednošću i ukazuju na ograničenu mogućnost ili odsustvo uspeha u selekciji osobina ranog stadijuma razvida cak i u slučaju postojanja diferencijalne adaptivne vrednosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

PRISUSTVO RUPICE NA BRADI I NA LICU U UZORKU IZ OKOLINE SUBOTICE

 

C. CEKUŠ

 

F. Kluza 23, Subotica

 

U okviru antropološkog i genetičkog proučavanja školske dece u okolini Subotice, izvršili smo i antroposkopsko istraživanje rupice na bradi i na licu. Rupica na bradi se javlja ili kao centralna ili uzdužna, a na licu (prilikom smejanja) može biti jednostrana ili obostrana, ili kao rupica ili u vidu linije. Cilj našeg rada je bio da ustanovimo frekvencu učestalosti obe rupice kod iste osobe, kao i međusobnu kombinaciju zapaženih rupica. Od ukupno pregledanih 1266 učenika - 653 dečaka i 613 devojaka - 342 (27.01%) imaju rupicu ili na bradi ili na licu. Od tog 342 slučaja svega 27 (7,89%) a od ukupnog uzorka 2,13% poseduje obe rupice: 11 dečaka i 16 devojaka. Najčešća kombinacija je jednostrana linija na licu i uzdužna jamica na bradi, to smo zapazili kod 7 učenika (25,93%) i kod 5 učenice (18,52%). Takođe, relativno često, u 2 slučaja se javlja obostrana rupice i uzdušna jamica na bradi. Kombinacija obostrana rupica na licu i centralna rupica na bradi, obostrana linija i centralna rupica kao i jednostrana linija i centralna rupica je zastupljena samo kod devojaka. Možemo zaključiti, da se rupice na bradi i na licu istovremeno jako retko jave, mada su ove osobine dominantne. Među polovima nema signifikantne razlike (χ2 = 0,92). Najčešća kombinacija je jednostrana linija na licu i uzdužna jamica na bradi.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJACIJA IVICE KOSE NA ČELU U UZORCIMA IZ SEVERNE SRBIJE

 

G. CEKUŠ


R. Kluza, Subotica

 

Ovaj rad je rezultat antroposkopskog proučavanja školske dece Severne Srbije. Cilj istraživanja je bio određivanje varijacije ivice kose na celu u četiri uzorka iz okoline Subotice (Backi Vinogradi, Hajdukovo, Horgoš i Male Pijace). Ova osobina je značajna za antropogenetiku. Tokom ispitivanja pregledani su svi učenici svakog naselja, ukupno 1266 (652 dečaka i 614 devojaka). Koristili smo modifikovanu samotoskopsku metodu po Lorencovoj. Po ovoj modifikovanoj metodi postoji 4 tipa granice kose u predelu čela: vodoravna, konveksna, konkavna i srcasta. Srcast je dominantan tip. Najčešće smo zapazili konveksnu ivicu kose (34,75%), što se odnosi i na dečake (33,44%) i na devojke (36,16%). Srcast oblik se javlja ređe, kod devojaka neznatno češće (25,90%) nego kod dečaka (24,08%). I po naseljima najčešće se zapaža konveksni oblik, od 31,97% (Hajdukovo) do 38,89% (B. Vinogradi). učestalost ovog oblika po uzrastu jako varira, od 21,55% (14 godina starosti) do 45,36% (7 godina starosti). Među pojedinim tipovima se javlja signifikantna razlika (χ2 = 131,550). Ne postoji značajna polna razlika, χ2 = 2.700. U okviru dečaka pojedini tipovi se signifikantno razlikuju, χ2 = 62,453 a u okviru devojaka ne, χ2 = 33,930. Na kraju, možemo zaključiti, da je u ovom uzorku konveksni tip ivice kose na čelu najviše zastupljen, mada frekvenca ovog oblika jako varira i po naseljima i po uzrastu. Srcast; oblik je u Hajdukovu najviše zastupljen (27,50%) u odnosu na ostala naselja.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENETIČKA STRUKTURIRANOST POPULACIJA TRI VRSTE GUŠTERA (Sauria: Lacertidae) NA PODRUČJU SKADARSKOG JEZERA

 

Jelka CRNOBRNJA-ISAILOVIĆ i I. ALEKSIĆ

 

Laboratorija za evolucionu biologiju, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Podarcis muralis, Lacerta oxycephala i Podarcis melisellensis predstavljaju najzastupljenije od šest vrsta guštera, pripadnika porodice Lacertidae, čiji areal rasprostranjenja obuhvata i oblast Skadarskog jezera. Osim obalnog pojasa, prisustvo ove tri vrste utvrđeno je i na nizu malih kraških ostrva (više od 27), poznatih u literaturi pod nazivom "jugozapadni arhipelag Skadarskog jezera". U sklopu obimnih evoluciono-bioloških i biogeografskih istraživanja analizirali smo metodom elektroforeze na skrobnom gelu uzorke ostrvskih i kopnenih populacija sve tri vrste. Glavni cilj ovog rada bio je utvrđivanje a potom i objašnjenje dobijenih nivoa genetičke diferencijacije između populacija unutar svake vrste, uključujući u razmatranja i mogući uticaj efekata izolacije. Rezultati su pokazali da se vrste razlikuju u stepenu genetičke strukturiranosti svojih populacija, održavajući već poznate činjenice o njihovoj mikrotaksonomiji i biogeografskim uticajima. U ovom konkretnom slučaju pokazalo se da alozimski podaci nisu dovoljni za precizno utvrđivanje puteva kolonizacije ostrva od strane analiziranih vrsta ili, pak, objašnjenje izražene fenotipske raznolikosti uočene u analiziranim populacijama. Ipak, pomoću već poznatih parametera (prosečna heterozigotnost po lokusu, proporcija polimorfnih lokusa, stopa protoka gena, raspodela retkih i jedinstvenih alela u populacijama), pokušali smo da prepoznamo procese koji bi mogli imati presudan uticaj na dobijene prostorne raspodele učestalosti alela.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

EFEKAT OSNIVAČA I MULTIVARIJANTNA SELEKCIJA

 

Dragana CVETKOVIĆ i N. TUCIĆ

 

Biološki fakultet PMF i IBI "Siniša Stanković", Beograd

 

Na efektu osnivača zasniva se više modela specijacije, međutim, ima malo podataka o stvarnom uticaju "osnivanja" na genetičku varijabilnost i diferencijaciju, posebno kada su u pitanju poligeni sistemi. U ovom radu dati su rezultati eksperimentalnog pristupa torn problemu, na pasuljevom žišku (Acanthoscelides obtectus) kao model sistemu. Analizirane su dve grupe kvantitativnih osobina, morfoloških i komponenti adaptivne vrednosti, i praćeni efekti 1 "bottleneck" epizode (drastičnog smanjenja brojnosti) različitog intenziteta na genetičku varijabilnost i diferencijaciju. Primena multivarijantnih metoda omogućila je merenje direktnih i indirektnih efekata selekcije u populacijama koje vode poreklo od različitog broja osnivača.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KVANTITATIVNO-GENETIČKA OSNOVA POVEĆANJA DUŽINE ŽIVOTA KOD PASULJEVOG ŽIŠKA (Acenlhoscelides obtectus)

 

Ivana GLIKSMAN

 

Laboratorija za evolucionu biologiju, Instituta za bioloska istraživanja "Siniša

Stanković, Beograd

 

U ovom radu analizirani su kvantitativno-genetički načini nasleđivanja kod kratko- i dugo- živećih linija, koje su dobijene posle višegeneracijske selekcije za ranu i kasnu reprodukciju. Za analizu su korišćene četiri "dugoživeće" linije ("old"), dve kontrolne linije ("control") i dve "kratkoživeće" linije ("young"), koje su pomenutim načinom selekcije dobijene iz sintetike laboratorijske populacije pasuljevog žiška. Serijom dialelnih analiza svih mogućih ukrštanja između različito selekcionisanih linija testirali smo heterogenost između linija odgovarajućih selekcionih tretmana. Takođe, procenjivan je efekat dominacije i materinski efekat na nizu ukrštanja između različito selekcionisanih linija (control x young; control x old i young x old). Analizirane su sledecc osobine: rani fekunditet, prvi i poslednji dan fekunditeta, kasni fekunditet, ukupan fekunditet i dužina života ženki i mužjaka. Materinskog efekta skoro da nema pri nasleđivanju analiziranih osobina kod "kontrol x young" i "kontrol x old" ukrštanja, dok kod "young x old" ukrštanja materinski efekat je prisutan za osobine: poslednji dan fekunditeta i dužina života ženki i mužjaka. Efekat dominacije je izrazitiji kod "control x young" ukrštanja (za osobine: prvi i poslednji dan fekunditeta, ukupan fekunditet i duzina života ženki i mužjaka) nego kod ostala dva tipa ukrštanja.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

SEKSUALNA SELEKCIJA I VELIČINA TELA KOD Drosophila melanogaster

 

V. KEKIĆ, Sofija PAVKOVIĆ-LUČIĆ, Aleksandra ČVORO i N. MILOŠEVIĆ

 

Biološki fakultet PMF-a i Inslitut za biološka istraživanja "Siniša Stanković", Beograd

 

U većine životinjskih vrsta činu kopulacije prethodi niz ponašajnih aktivnosti koje su verovatno najsloženije od svih koje data vrsta ispoljava. Dešava se fenomen koji nazivamo udvaranjem. Njegov biološki smisao je višestruk, a osnovni je u tome da se tokom ovog procesa prepoznaju jedinke iste vrste i vrši, kod određenih životinja, fina sinhronizacija različitih ciklusa koji dovode jedinke suprotnog pola u odgovarajuće fiziološko stanje neophodno za uspešnu kopulaciju. Tokom ovog procesa odvija se još jedan izuzetno značajan fenomen, koji je još Darwin (1859,1871) uočio a Fusher (1930, 1958) među prvima teorijski raspravljao. Dešava se fenomen seksualne selekcije Darwin i Fisher, kao i mnogi savremeni teoretičari prave razliku između seksualne i prirodne selekcije, pri čemu je prva prisutna kada postoji varijansa u uspešnosti ostvarivanja kopulacija, a druga, kada je prisutna varijansa u ostalim komponentama fitnesa (npr. preživljavanju, fertilitetu jedinki koje su ostvarili kopulaciju). Teorijske analize genetičkih osnova mehanizama seksualne selekcije sugerišu nekoliko mogućih načina na koji ona može da se promoviše iz generacije u generaciju. Pri ovome, obično se pravi razlika između procesa zasnovanih na kompeticiji između muzjaka i onih na kojima počiva izbor muzjaka koji vrši ženka. U praksi, u eksperimentalnim istraživanjima mehanizama seksualne selekcije problem se u prvom koraku svodi na detektovanje karaktera koji bi bio u korelaciji sa reproduktivnim uspehom jednog ili drugog pola, koji bi, npr. jednog muzjaka činio uspešnijim od drugog bez obzira na to da li je u pitanju posledica borbe između njih za ženku ili/i posledica izbora koji ženka vrši. U eksperimentu koji prezentiramo pažnja je bila usmerena na telesne dimenzije oba pola. Istraživanja smo vršili u laboratoriji i u prirodi. Cilj nam je bio da utvrdimo: (1) da li je kod Drosophila melanogaster prisutno ne slučajno parenje u odnosu na veličinu tela, tj. da li je uspešnost u parenju veličina zavisna pojava, (2) da li je i u kojoj meri ova pojava učestalost zavisna tj. da li se efekat veličine tela menja u funkciji broja i proporcije muzjaka i ženki u uzorku i (3) da li je prisutno veličina-zavisno asortativno ukrštanje, tj. da li postoji korelacija između veličine muzjaka i ženki koji su stupili u kopulaciju.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POPULACIONO GENETIČKA ANALIZA LEVORUKOSTI KOD STANOVNIŠTVA PROKUPLJA

 

D. KNEŽEVIĆ, D. MARINKOVIĆ 1, LJ. AGRAMOVIĆ 2


Institut za istraživanja u poljoprivredi "Srbija", Centar za strna žita "Kragujevac", Kragujevac

1 Prirodno-matematički fakultet, Univerzitet u Beogradu, Beograd;

2 Prirodno-matematički fakultet, Univerzitet u Podgorici, Podgorica

 

Populaciona izučavanja rukosti su pokazala da se ovo svojstvo ispoljava u dva tipa i to kao levorukost ili desnorukost. Ispitivanjem je obuhvaćeno 180 porodica (360 roditelja i 324 dece) i 810 dece (učenika). Ukupno 1494 ispitanika. Posmatrano je prisustvo ispoljavanja recesivne osobine odnosno odsustvo u slučaju kada je ispoljena dominantna osobina. Ustanovljeno je da je učestalost ispoljavanja levorukosti (810 jedinki) u posmatranom uzorku bila 13,8%, q = 0,37. Proučavanja nasleđivanja levorukosti u 180 porodica je pokazalo da ne postoje značajne razlike u ispoljavanju ovog svojstva između roditelja i dece kao i između polova.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

KVANTITATIVNO GENETIČKA ANALIZA KOMPONENTI ADAPTIVNE VREDNOSTI KOD DVE LABORATORIJSKE POPULACIJE PASULJEVOG ŽIŠKA (Acanthoscelides obtectus)

 

Stanislava MIKULJANAC i O. STOJKOVIĆ

 

Laboratorija za evolucionu biologiju, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Ovaj rad se bavi određivanjem obrazaca genetičke varijabilnosti i kovarijabilnosti između komponenti adaptivne vrednosti kod dve populacije pasuljevog žiška (Acanthoscelides obtectus) koje su oko 60 generacija gajene na pasulju i nautu. U cilju određivanja interakcija genotip X sredina, unutar svake od populacija sprovedeni su eksperimenti koji su se zasnivali na podeli porodica na dve sredine (pasulj nasuprot nautu). Korišćenjem genetičke varijanse čija je ekspresija sredinski zavisna za različite komponente adaptivne vrednosti (preadultni varijabilitet, trajanje preadultnog razvida, fekunditet i duzina života ženki) moguce je proceniti stepen genetičkih antagonističkih relacija (engl. trade-off) među komponentama adaptivne vrednosti unutar populacija. Primenom tzv. "half-sib" analiza je određena i genetička varijansa preferencije ženki za polaganje jaja (koja je ovde definisana kao % jaja položenih na nautu = (broj jaja na nautu)/(ukupan broj jaja) X 100 a zatim je ispitivano da li je varijabilnost u ovoj osobini korelisana sa nekim komponentama adaptivne vrednosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

VARIJABILNOST NEKIH KOMPONENTI ADAPTIVNE VREDNOSTI RAZLIČITIH GENOTIPOVA Amy LOKUSA KOD Drosophila subobscura U ZAVISNOSTI OD SASTAVA SUPSTRATA

 

Mirjana MILANOVIĆ i M. ANĐELKOVIĆ

 

Institut za biološka istraživanja "Siniša Stanković", Odeljenje za genetiku, Beograd

 

Alfa amilaza kod jedinki D.subobscura je polimorfan enzim. Selekcijom su dobijene homozigotne linije za "spori" i "brzi" amilazni alel i u njima je određivana varijabilnost nekih komponenti adaptivne vrednosti pod određenim sredinskim uslovima. Dobijeni rezultati pokazuju da između linija selekcionisanih za navedene amilazne alele postoji razlika u brzim preadultnog razvida, preživljavanja, duzini života adulta kao i aktivnosti amilaze na čisto skrobnom, čisto maltoznom i standardnom supstratu. Jedinke SS genotipa imaju brze preadultno razvide, bolje preživljavanje i kradu duzinu života imaga od jedinki BB genotipa na skoro sva tri tipa supstrata. Analiza rezultata aktivnosti amilaze na različitim supstratima pokazuje da ne dolazi do povećanja aktivnosti enzima na skrobnom supstratu u odnosu na standardni. Najniža aktivnost amilaze je na maltoznom supstratu u obe selekcionisane grupe. Ograničavajući uslovi ishrane, pri čemu su skrob i maltoza jedini izvori ugljenih hidrata, verovatno stvaraju uslove fiziološkog stresa što je i pokazano pri analizi nekih komponenti adaptivne vrednosti.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

MEHANIZMI ODRŽAVANJA GENETIČKE VARIJABILNOSTI ZA IZBOR DOMAĆINA KOD PASULJEVOG ŽIŠKA (Acanthoscelides obteclus)

 

Dragana MILANOVIĆ i Sofija KARAULIĆ

Laboratorija za evolucionu biologiju, Institut za biološka istraživanja "Siniša Stanković", Beograd

 

Postoje dva objašnjenja kako se održava genetička varijabilnost za izbor domaćina kod fitofagnih insekata. Prvo, genetička varijabilnost za izbor domaćina održavala bi se zbog postojanja genetičkih korelacija između preferencije i performanse. Drugo objašnjenje zasniva se na pretpostavci da ako preživljavanje na nekom domac"inu zavisi od gustine populacije, genetička varijabilnost za izbor domaćina bi se održavala prirodnom selekcijom koja favorizuje genotipove koji omogućavaju isti vijabilitet potomaka na različitim domaćinima. Naši eksperimenti sa Acanthoscelides obtecius sugerišu da višegeneracijsko održavanje na dva domaćina (Cicer arietinum i Phaseolus vulgaris) može da dovede do različite osetljivosti izbora domaćina na gustinu adulta. U Cicer populaciji nismo uočili efekte na izbor domaćina koji zavise od gustine odraslih jedinki, dok su u populaciji Phaseolus ti efekti uočeni. Ovi rezultati ukazuju da bi na primarnom domaćinu (pasulj) genetička varijabilnost za izbor domaćina bila održavana selekcijom zavisnom od gustine, dok bi na novom domaćinu (naut) mehanizam održavanja genetičke varijabilnosti izbora domaćina mogao biti genetička korelacija između preferencije (majki) i neke komponente adaptivne vrednosti potomaka.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UČENJE KOD Drosophila melanogaster UTICAJ NA GENETIČKU STRUKTURU

 

N. MILOŠEVIĆ, V. KEKIĆ, Sofija PAVKOVIĆ-LUČIĆ i Aleksandra ČVORO

 

Institut za biološka istraživanja "Siniša Stanković" i Biološki fakultet MPF-a, Beograd

 

Sve do nedavno, u teorijskim populaciono-genetičkim razmatranjima, ponašanje skoro da i nije bilo prisutno, a ako je bilo neophodno da se pomene, onda se po pravilu polazilo od toga da se sve jedinke na isti način ponašaju (npr. ukrštaju se po principu slučajnosti, migriraju po istom principu, ravnomerno su distribuirane u prostoru koji naseljavaju, itd.). Ponašanje je u celini, a verovatno i većina ponašajnih osobina su po sebi par excellence fitnes osobine, jer je čitav život svake individue jedan kontinuum najrazličitijih oblika ponašanja. Pri ovome, ako je određeno ponašanje genetički korelisano sa nekom od standardnih fitnes komponenti (preživljavanjem, fertilitetom, itd.) onda njegova uloga u evolucionim procesima postaje sasvim očigledna. Onog trenutka kad su u teorijske modele uključene i realne činjenice, da su staništa lokalnih populacija ekološki hcterogena i varijabilna i da individue u okviru njega biraju "mikro" staništa (što predstavlja akt ponašanja) u kojima će njihov fitnes biti veći, ostvareni su uslovi koji, uz ostale ranije mehanizime (i neke novije, npr. učestalost-zavisne i gustina zavisne) na daleko uspešniji način objašnjavaju "stari" teorijski problem, visoku genetičku polimorfnost prirodnih populacija. Sa druge strane, o genetičkim osnovama preferencije staništa, o njenoj genetičkoj korelisanosti sa ostalim fitnes komponentama veoma malo se zna. Još manje se zna o ulozi učenja, o ulozi iskustvom izmenjenih ponašanja aktivnosti koje su od značaja za preživljavanje, za reprodukciju, za izbor staništa. Cilj našeg rada je bio da utvrdimo da li i u kojoj meri u laboratorijskim uslovima u složeno dizajniranim eksperimentima mušice mogu da koriste prethodno iskustvo (pozitivno ili negativno), da ga memorišu i da u ponovljenoj situaciji reaguju na adekvatan način. Pri ovome, mušice su uslovljavane da uz pomoć različitih vizuelnih, olfaktornih i gustativnih stimulusa vrše izbor određenog prostora. Na primer, ako tokom treninga mušice dobijaju hranu na žuto obojenoj podlozi, da li će u test proceduri preferirati žuto obojenu podlogu. U drugoj seriji eksperimenata posmatrano je da li razviće na određenom supstratu, ili boravak u prvim časovima života adulta na određenom supstratu utiču na kasniji izbor supstrata (za ishranu, za polaganje jaja, itd.). Najzad, posmatrano je, da li izvršen izbor utiče na fitnes komponente, kako individue koja je izvršila izbor, tako i njenih potomaka.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

UTICAJ TRAUME NA PROMENU KONCENTRACIJE HAPTOGLOBULINA I a2 MAKROGLOBULINA U AO I DA INBREDOVANIM SOJEVIMA PACOVA

 

Milica MILOŠEVIĆ 1, Z. MAGIĆ 1, Č. RADOJIČIĆ 1, i D. MARINKOVIĆ 2

 

1 Institut za medicinska istraživanja VMA, Beograd;

2 Biološki fakultet PMF, Beograd

 

Odgovor organizma na traumu je poligeno regulisan, ali verovatno neki gen, ili grupa gena doprinose više nego drugi u smislu veto otpornosti organizama na traumu. Najizrazitija reakcija u okviru metaboličkih promena je povećana sinteza proteina akutne faze (AFP). Ovo je heterogena grupa proteina čija je glavna uloga da pomognu traumatizovanom organizmu da ponovo uspostavi narušenu homeostazu. Haptoglobin (Hp) i naročito a2-makroglobulin (a2-MG) spadaju u glavne proteine akutne faze u pacova. Sojevi AO (Albino Oxford) i DA (Dark Augustin) su različito osetljivi na traumu te smo u našim istraživanjima poSH od pretpostavke da oni mogu imati različite koncentracije Ph i a2-MG u serumu. U torn cilju smo raketnom imunoelektroforezom merili koncentraciju ova dva proteina u serumu intaktnih i traumatizovanih pacova (24 časa nakon turnike traume) i to u roditeljskih i potomačkih generacija dobijenih njihovim ukrštanjem. Dobijeni rezultati su pokazali da su bazalne vrednosti Hp i a2-MG u AO i DA sojeva različite. Veće koncentracije su nađene u otpornijem AO soju što sugeriše da ovi proteini mogu doprineti većoj otpornosti ovog soja na povredu. Posle delovanja traume koncentracija oba proteina se značajno povećava kod roditelja kao i kod svih potomačkih generacija (F1, F2, "backcross"). Ove koncentracije su približno iste za oba soja što znači da regulatorni mehanizmi DA soja svojom aktivnošću prevazilaze razlike koje su postojale u bazalnim koncentracijama. Individualna varijabilnost koja je prisutna kod oba soja, takođe se smanjuje posle delovanja traume. Ovo smanjenje individualne varijabilnosti kao i činjenica da su prosečne vrednosti koncentracija Hp i a2-MG posle povrede približno jednake u svim generacijama, navodi nas na zaključak da postoje neke optimalne koncentracije ova dva proteina koje organizam tezi da postigne.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POPULACIONO-GENETIČKA ISPITIVANJA RECESIVNIH KARAKTERISTIKA U LJUDSKIM POPULACIJAMA "IZOLATIMA" U CRNOJ GORI

 

V. NOVOSEL

Medicinski institut, Univerzitet Crne Gore, Podgorica

 

Cilj rada je da se utvrdi genetička opterećenost kod nekih ljudskih populacija - izolata na malim i skučenim prostorima življenja. Potreba za ovim istraživanjima jeste učestalost psihopatskih oboljenja kod jednog broja porodica. Ovim ispitivanjem obuhvaćeno je 154 osobe svih uzrasta. Radi komparacije podataka ispitan je uzorak ljudi od 100 kao kontrolna grupa iz Podrogice. Uzeto je 20 karakterističnih fenotipskih osobina za ispitivanje recesivnog nasleđivanja. Pošto se radi o prirodno izolovanim ljudskim populacijama, postoje objektivni uslovi za nastajanje "genetičkog drifta" koji je imao za posledicu izmenu genetičke strukture ispitivane populacije. Na osnovu primjene adekvatnih statističkih metoda utvrđene su značajne razlike između studijske i kontrolne grupe po pitanju učestalosti homozigotno recesivnih nasleđivanja osobina na nivo vrijednosti p = 0,05 do p = 0,001.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

IZRAČUNAVANJE FAKTORA RIZIKA ZA NASTANAK BOLESTI KALEMA PROTIV DOMAĆINA IZAZVANE TRANSFUZIJOM

 

D. PAUNOVIĆ, R. SIMONOVIĆ, I. STOLIĆ i M. DOKIĆ

 

Zavod za transfuziju krvi Srbije, Beograd

 

Na osnovu svih do sada proučenih slučajeva transfuzijom izazvane bolesti kalema protiv domaćina (TA-GVHD) zaključeno je da poseban rizik za njen nastanak predstavlja donor koji je homozigot za jedan od recipijentovih HLA haplotipova. Zbog visokog mortaliteta izazvanog TA-GVHD preporučuje se ozračivanje svih jedinica krvi koje se primenjuju kod imunokompromitovanih pacijenata. Izračunavanje rizika za nastanak ovog oboljenja vrši se na osnovu formula koje su bazirane na frekvenci pojedinih haplotipova u populaciji i verovatnoća da donor bude homozigot a recipijent heterozigot za isti haplotip. Na osnovu učestalosti haplotipova izračunat je relativni rizik za porodične i slučajno odabrane donore kod haplotipova za različitom zastupljenošću u našoj populaciji. Rezultati pokazuju da je rizik znatno veći ukoliko su donor i recipijent u većem stepenu srodstva, a u korelaciji je sa frekvencom haplotipova u populaciji.

 

VREDNOSTI RELATIVNOG RIZIKA

                          .         

srodstvo      

roditelji

deca

baba, deda ujaci...

 

braća sestre              

prvi rođaci

drugi rođaci

nesrodni

haplotip IILA

 

X 10-9

X 10-9

X 10-9

X 10-9

X 10-9

X 10-9

A2B5

 

4,68 (7,09)

 

2,67

(4,04)

2,51

(3,80)

1,66 (2,51)

 

0,91

(1,38)

0,66

(1)

A2K15

 

0,09 (52,10)

 

0,05 (26,52)

 

0,049

(26,26)

0,026 (13,68)

 

0,008 (4,21)

 

0,0019

(1)

 

Vrednosti u zagradama odgovaraju riziku u odnosu na nesrodne

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

POTENCIJAL BROJA ĆELIJA I VELIČINA SISTEMA JEDINKE I POPULACIJE


B.P. PAVLOVIĆ

 

Veterinarski fakultet, Beograd

 

Osnovni biotički sistemi su ćelija i jedinka. U njima se ostvaruje cjelovit skup biotičkih funkcija. Potencijalni broj ovih sistema je određen karakteristikama vrste organizma. Analizirane su dvije karakteristike vrste, veličina jedinke (kao konačan broj generacija ćelijskih dioba u njoj, k) i reproduktivni potencijal. Ćelijskom diobom, kod gotovo svih vrsta, nastaju dvije telije, a broj ćelija jedinke (Li) je funkcija generacije ćelijskih deoba (i, i = 0 do k): Li = 21. Radi poređenja reprodukcija ćelije I jedinke, neka jedna jedinka proizvodi dvije jedinke poslije k-generacija sinhronih ćelijskih dioba (na kraju svog života). Broj jedinki u populaciji (Nj) je funkcija generacije jedinki (j) i početnog broja jedinki (No): Nj = No2J. Interval generacije jedinki (j = 0, 1, 2,....) obuhvata k plus 1 generacija ćelija (i = 0, 1, 2,....., k). Broj ćelija u populaciji (Ljj) dobije se iz relacije: Ljj=Nj2J. Broj generacija jednoćelijskih jedinki (j.u) povezan je sa brojem generacija višecelijskih jedinki (jv), sa konačnom veličinom jedinke (kv), preko jednačine: ju=jv(kv+I)+i. Što je veće k, to su veće oscilacije Lji, a sporiji rast Nj u populaciji. Neki aspekti ovih unutrašnjih odlika biotičkih sistema razmatrani su u vezi sa dominacijom haploidnog ili diploidnog stanja, sa prenosom ćelija u narednu generaciju, sa brojem ostvarenih biotičkih sistema i sa njihovom veličinom i vremenom. Maksimalnu razmjeru biotičkog prostora određuje suma broja sistema (ćelija - dioba, jedinka - reprodukcija), a promjene i kombinovanje (rekombinovanje) genetičkih informacija odigrava se u tom prostoru.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

NESLUČAJNE ASOCIJACIJE GENA HLA A I HLA B LOKUSA KOD STANOVNIŠTVA SRBIJE

 

R. SIMONOVIĆ, D. PAUNOVIĆ, I. STOLIĆ i V.D. MILETIĆ

 

Zavod za transfuziju krvi Srbije, Beograd

 

Ovaj rad je deo opširnije studije genetičke varijabilnsoti određenih genetičkih markera u našoj populaciji. Analizirana je vrednost koeficijenta gametskog disekvilibrijuma (D) između gena HLA-A i HLA-B lokusa u uzorku od 1329 nesrodnih osoba uključenih u program veštačenja spornog roditeljstva. U našoj populaciji je uočeno 48 signifikantnih D vrednosti. Najviše pozitivne vrednosti su karakteristika haplotipova HLA A1B8 (0,781), HLA A1B37 (0,819), Aw19B70 (0,938) i Aw33B14 (0,819). Primenom DPA (Disequilibrium Pattern Analysis) od 33 grafikona kojima su obuhvaćene sve alelske kombinacije, u našoj populaciji uočena su 3 karakteristična haplotipa i to HLA A1B8, HLA A3B7 i HLA Aw33B14. Najkarakterističniju sliku, koja uka/uje na delovanje prirodne selekcije u formiranju i održavanju gametskog disekvilibrijuma, dobili smo za kombinacije alela HLA-B8 sa alelima A lokusa.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

Proctolaelaps regalis KAO MOGUĆI VEKTOR U HORIZONTALNOM TRANSFERU P ELEMENTA IZMEĐU VRSTA Drosophila species

 

M. STAMENKOVIĆ-RADAK, J.B. CLARK i M. KID WELL

 

Department of Ecology and Evolutionary Biology, University of Arizona,

Tuscon, USA i Odeljenje za genetiku, Institut za bioloska istraživanja "Siniša

Stanković", Univerzitet u Beogradu, Beograd

 

Parazitski krpelj Proctolaelaps regalis je u skorašnjim radovima opisan kao mogući vektor u horizontalnom (nezavisnom od parenja) transferu delova DNK između nekih vrsta Drosophila. U ovom radu, četiri odvojene kombinacije različitih vrsta Drosophila gajene su sa i bez Proctolaelaps regulis u kulturi sa ciljem da se utvrdi da li ce prisustvo krpelja uticati na prenos P elementa iz jedne vrste (P) u drugu (M). Uzorci jedinki M vrste uzimani su nakon nekoliko generacija da bi se detektovalo eventualno prisustvo P elementa u genomu, putem testa za gonadalni sterilitet i polimerazne lančane reakcije (PCR). Krpelji iz eksperimentalnih kombinacija takođe su testirani na prisustvo P elementa. Održavanje dve vrste Drossophila i Proctolaelaps regalis zajedno, u datim laboratorijskim uslovima, može biti pogodan model-sistem u otkrivanju i izučavanju lateralnog genskog transfera. Biološke različitosti i specifičnosti svih vrsta uključenih u ovakav tip eksperimenata čine takav događaj retkim, ali mogućim. Ponašanje u ishrani, kao i ostale osobine Proctolaelaps regalis, stvaraju uslove slične metodi mikroiniciranja embriona Drosophila koja se koristi u istraživanjima transformacije putem P elementa. Podaci koji se odnose na prirodu preuzimanja i zadržavanja DNK (P elementa Drosophila) od strane krpelja, doprinose razumevanju ovog fenomena koji bi bio od izuzetnog evolutivnog značaja.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

SELEKCIJA ZA RAZLIČITO VREME DO PRVOG PARENJA KOD Drosophila melanogaster

 

Snežana STANIĆ 1 i D. MARINKOVIĆ 2

1 Institut za biologiju PMF, Kragujevac
2 Institut za zoologiju, Biološki fakultet Univerziteta u Beogradu, Beograd

 

Imajući u vidu evolutivni značaj procesa parenja kod Drosophila, cilj rada bila je selekcija za različito vreme do prvog parenja kod Drosophila melanogaster kako bi se dobile linije dije jedinke imaju pretežno brzo, odnosno sporo sparivanje. U svakoj generaciji selekcionisanih linija beležen je i broj potomaka. Da bi se pratio eventualni uticaj uslova kompeticije na ispitivane komponente fitnesa, selekcija je rađena u dve replike: I za dobijanje naredne generacije odvajan je po jedan par jedinki; II za dobijanje naredne generacije u teglicama je čuvano po deset parova jedinki D.melanogaster. Posle devet generacija selekcije dobijene su spore linije sa vremenom do prvog parenja 2363 sec (bez uslova kompeticije) i 2402 sec (pri uslovima kompeticije) i brze linije sa vremenom do početka parenja 100 sec (bez uslova kompeticije) i 160 sec (ukoliko su prisutni uslovi kompelicije). Unutar selekcionisanih linija srednje vreme do prvog parenja varira, ali je selekcioni odgovor prisutan. Varijabilnost je manje izražena u brzim linijama nego u sporim. Kvantitatinvo-genetička analiza dobijenih rezultata pokazala je da je nasledljivost veća u sporim linijama. Koeficijenti heritabilnosti u slučajevima selekcije za sporo sparivanje iznosi h2 = 0,614 i h2 = 0,386, a za brzo sparivanje h2 = 0,0241 i h2 = 0,0243. Dobijene vrednosti prosečne nasledljivosti ovog kvantitativnog svojstva po generaciji dobijene su iz odnosa R/SD (). U selekcionisanim linijama uočava se varijabilnost broja potomaka, a vrednosti koeficijenata korelacije pokazuju da ne postoji pravilnost u korelativnom odgovoru.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije

 

 

GENI VIRULENTNOSTI U POPULACIJI Erysiphe graminis f. sp. tritici

 

S. STOJANOVIĆ i Jovanka STOJANOVIĆ

 

Institut za istraživanja u poljoprivredi "Srbija" - Beograd, Centar za strna žita,

Kragujevac

 

Populacija prouzrokovača pepelnice pšenice sastoji se iz različitih gena virulentnosti. Pomoću serije izogenih linija, kao i nekih sorti sa poznatim genima otpornosti, obavljena je identifikacija gena virulentnosti na području Srbije. Ispitivanja su obavljena u Centru za strna zita u Kragujevcu u 1990. i 1991. godini. utvrđeno je da se populacija ove parazitske gljive u nas sastoji iz više gena virulentnosti (VI, V2, V3a, V3b, V3c, V4a, V4b, V5, V6, V7, V8, V9, V2+V6 i V5+V6). Njihova u&stalost u 326 ispitanih isolata je bila različita i kretala se od 6,17% (V5+V6) do 96,35% (V5). Učestalost ostalih gena virulentnosti je iznosila VI (92,13%), V2 (78,02%), V3a (73,25%), V3b (49,12%), V3c (84,76%), V4a (37,20%), LV4b (22,04%), V6 (88,29%), V7 (81,46%), V8 (77,32%), V9 (56,11) i V2+V6 (18,12%). Međusobni odnosi gena virulentnosti u zajedničkim izolatima ukazuju na različit stepen patogenosti određenih kultura gljive. Broj gena virulentnosti u jednom izolatu se kretao od 2 do 12, a najviše izolata je bilo sa 8 i 9 gena virulenlnosti. Rezultati proučavanja genetske strukture virulentnsoti populacije prouzrokovača pepelnice pšenice u Srbiji ukazuju na potrebu identifikacije novih gena otpornosti, §to će doprineti proširenju znanja o učestalosti alela virulentnosti u populaciji parazita.

 

Povratak na sadržaj



 

Štampano u Zborniku abstrakta „PRVI KONGRES GENETIČARA SRBIJE“

Vrnjačka Banja, 08-11. juni 1994.

© 1994 Društvo genetičara Srbije